Rmu_sc0033687.1_g000001
HSP70 Family

Belongs to the heat shock protein 70 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0033687.1
OG0001841
Physical Location & Seq
Reverse (-)
2 .. 786
785 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0033687.1_g000001.1.cds

Sequence Viewer

Length: 331 bp
atggcgggagaagaaaagggccaggcaattgggatcgatctagggacgacttactcttgcgtagcagtttggcagaacgatcatgtggaaatcatggtgaatgatcagggcaacaggaccactccatcttatgttgccttcaatgatactgagcgtttggttggtgatgcagctttcaaccaggtcatcaagaaccccatcaattccgtatttgatgcaaagcgattaataggtaggaggttcagtgacgactctgttcaaagtgatatgaagctctggccattcaaggtcattgaaggtgttgatgacaagcctatgattgtggttagcc
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko04010 ko04141 ko04144 ko04213 ko04612 ko04915 ko05134 ko05145 ko05162 ko05164 ko05169 map03040 map04010 map04141 map04144 map04213 map04612 map04915 map05134 map05145 map05162 map05164 map05169
Pfam Domains
Protein Families
HSP70

Protein Analysis

110

Amino Acids

12.22

Weight (kDa)

4.67

Isoelectric Point (pI)

28.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 5
AclWI GGATC 1 cut(s) 41
AcoI YGGCCR 1 cut(s) 278
AgsI TTSAA 5 cut(s) 142, 178, 260, 286, 296
AjnI CCWGG 2 cut(s) 21, 180
AluBI AGCT 2 cut(s) 173, 274
AluI AGCT 2 cut(s) 173, 274
AlwI GGATC 1 cut(s) 41
AoxI GGCC 2 cut(s) 19, 278
ApeKI GCWGC 1 cut(s) 170
AseI ATTAAT 1 cut(s) 227
AspS9I GGNCC 2 cut(s) 19, 117
AsuHPI GGTGA 2 cut(s) 109, 176
AvaII GGWCC 1 cut(s) 117
BalI TGGCCA 1 cut(s) 280
BbvI GCAGC 1 cut(s) 182
BccI CCATC 2 cut(s) 133, 206
BciT130I CCWGG 2 cut(s) 23, 182
BclI TGATCA 1 cut(s) 103
BfaI CTAG 1 cut(s) 41
BisI GCNGC 1 cut(s) 171
BlsI GCNGC 1 cut(s) 172
Bme1390I CCNGG 2 cut(s) 23, 182
Bme18I GGWCC 1 cut(s) 117
BmgT120I GGNCC 2 cut(s) 19, 117
BmrFI CCNGG 2 cut(s) 23, 182
BmsI GCATC 2 cut(s) 157, 205
Bsa29I ATCGAT 1 cut(s) 36
BsaXI ACNNNNNCTCC 2 cut(s) 229, 259
BseBI CCWGG 2 cut(s) 23, 182
BseCI ATCGAT 1 cut(s) 36
BseMII CTCAG 1 cut(s) 141
BseXI GCAGC 1 cut(s) 182
BshFI GGCC 2 cut(s) 21, 280
BshVI ATCGAT 1 cut(s) 36
BslFI GGGAC 1 cut(s) 58
BsmFI GGGAC 1 cut(s) 58
BsnI GGCC 2 cut(s) 21, 280
Bsp143I GATC 4 cut(s) 33, 37, 79, 103
BspACI CCGC 1 cut(s) 5
BspANI GGCC 2 cut(s) 21, 280
BspCNI CTCAG 1 cut(s) 142
BspDI ATCGAT 1 cut(s) 36
BspPI GGATC 1 cut(s) 41
BssMI GATC 4 cut(s) 33, 37, 79, 103
Bst2UI CCWGG 2 cut(s) 23, 182
BstDEI CTNAG 1 cut(s) 150
BstKTI GATC 4 cut(s) 36, 40, 82, 106
BstMBI GATC 4 cut(s) 33, 37, 79, 103
BstNI CCWGG 2 cut(s) 23, 182
BstSCI CCNGG 2 cut(s) 21, 180
BstV1I GCAGC 1 cut(s) 182
BstXI CCANNNNNNTGG 1 cut(s) 29
Bsu15I ATCGAT 1 cut(s) 36
BsuRI GGCC 2 cut(s) 21, 280
BsuTUI ATCGAT 1 cut(s) 36
BtsIMutI CAGTG 1 cut(s) 250
Cfr13I GGNCC 2 cut(s) 19, 117
ClaI ATCGAT 1 cut(s) 36
CsiI ACCWGGT 1 cut(s) 180
CviAII CATG 2 cut(s) 83, 94
CviJI RGCY 6 cut(s) 21, 173, 274, 280, 313, 330
CviKI_1 RGCY 6 cut(s) 21, 173, 274, 280, 313, 330
DdeI CTNAG 1 cut(s) 150
DpnI GATC 4 cut(s) 35, 39, 81, 105
DpnII GATC 4 cut(s) 33, 37, 79, 103
EaeI YGGCCR 1 cut(s) 278
Eco47I GGWCC 1 cut(s) 117
EcoRII CCWGG 2 cut(s) 21, 180
FaeI CATG 2 cut(s) 86, 97
FaiI YATR 5 cut(s) 84, 95, 132, 269, 317
FaqI GGGAC 1 cut(s) 58
FatI CATG 2 cut(s) 82, 93
FbaI TGATCA 1 cut(s) 103
Fnu4HI GCNGC 1 cut(s) 171
Fsp4HI GCNGC 1 cut(s) 171
FspBI CTAG 1 cut(s) 41
GluI GCNGC 1 cut(s) 171
HaeIII GGCC 2 cut(s) 21, 280
Hin1II CATG 2 cut(s) 86, 97
HinfI GANTC 1 cut(s) 251
HphI GGTGA 2 cut(s) 109, 176
Hpy188III TCNNGA 1 cut(s) 190
HpyAV CCTTC 2 cut(s) 148, 290
HpyCH4V TGCA 2 cut(s) 170, 218
HpyF3I CTNAG 1 cut(s) 150
Hsp92II CATG 2 cut(s) 86, 97
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 4 cut(s) 33, 37, 79, 103
LpnPI CCDG 7 cut(s) 8, 35, 92, 100, 167, 194, 262
Lsp1109I GCAGC 1 cut(s) 182
LweI GCATC 2 cut(s) 157, 205
MabI ACCWGGT 1 cut(s) 180
MaeI CTAG 1 cut(s) 41
MaeIII GTNAC 1 cut(s) 245
MalI GATC 4 cut(s) 35, 39, 81, 105
MboI GATC 4 cut(s) 33, 37, 79, 103
MboII GAAGA 1 cut(s) 23
MfeI CAATTG 1 cut(s) 27
MlsI TGGCCA 1 cut(s) 280
MluCI AATT 2 cut(s) 27, 202
MluNI TGGCCA 1 cut(s) 280
MlyI GAGTC 1 cut(s) 245
MnlI CCTC 1 cut(s) 231
Mox20I TGGCCA 1 cut(s) 280
MscI TGGCCA 1 cut(s) 280
MseI TTAA 1 cut(s) 227
Msp20I TGGCCA 1 cut(s) 280
MspR9I CCNGG 2 cut(s) 23, 182
MunI CAATTG 1 cut(s) 27
MvaI CCWGG 2 cut(s) 23, 182
NdeII GATC 4 cut(s) 33, 37, 79, 103
NlaIII CATG 2 cut(s) 86, 97
NmuCI GTSAC 1 cut(s) 245
PkrI GCNGC 1 cut(s) 172
PleI GAGTC 1 cut(s) 245
PpsI GAGTC 1 cut(s) 245
PshBI ATTAAT 1 cut(s) 227
Psp6I CCWGG 2 cut(s) 21, 180
PspGI CCWGG 2 cut(s) 21, 180
PspPI GGNCC 2 cut(s) 19, 117
SaqAI TTAA 1 cut(s) 227
SatI GCNGC 1 cut(s) 171
Sau3AI GATC 4 cut(s) 33, 37, 79, 103
Sau96I GGNCC 2 cut(s) 19, 117
SchI GAGTC 1 cut(s) 245
ScrFI CCNGG 2 cut(s) 23, 182
SetI ASST 7 cut(s) 175, 186, 235, 242, 276, 291, 301
SexAI ACCWGGT 1 cut(s) 180
SfaNI GCATC 2 cut(s) 157, 205
SinI GGWCC 1 cut(s) 117
Sse9I AATT 2 cut(s) 27, 202
SsiI CCGC 1 cut(s) 5
SspMI CTAG 1 cut(s) 41
StyD4I CCNGG 2 cut(s) 21, 180
TaqI TCGA 1 cut(s) 36
TasI AATT 2 cut(s) 27, 202
Tru1I TTAA 1 cut(s) 227
Tru9I TTAA 1 cut(s) 227
TscAI CASTG 1 cut(s) 250
TseFI GTSAC 1 cut(s) 245
TseI GCWGC 1 cut(s) 170
Tsp45I GTSAC 1 cut(s) 245
TspDTI ATGAA 1 cut(s) 284
TspGWI ACGGA 1 cut(s) 196
TspRI CASTG 1 cut(s) 250
VpaK11BI GGWCC 1 cut(s) 117
VspI ATTAAT 1 cut(s) 227
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.