Rh7DG196300
HSP70 Family

Belongs to the heat shock protein 70 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
OG0001841
Physical Location & Seq
Reverse (-)
18445390 .. 18446028
639 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG196300.1

Sequence Viewer

Length: 258 bp
ATGGCTATGGTTGCAAAAAGCGAGGGTCCAGCGATTGGTATCGACCTTGGTACAACCTATTCATGCGTTGGTGTCTGGCAACATGGCCGTGTTGAGATCATAGCCAATGACCAGGGCAACAGAACGACACCATCTTATGTTGCTTTTACCGACACTAGACGTTTAATTGGTGATGCCGCCAAAAACCAAGCCTCCATGAACCCTATCAACACTGTTTTTGTAATGAACTTAGGACCTGCAAATCAAGGTTTGCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko04010 ko04141 ko04144 ko04213 ko04612 ko04915 ko05134 ko05145 ko05162 ko05164 ko05169 map03040 map04010 map04141 map04144 map04213 map04612 map04915 map05134 map05145 map05162 map05164 map05169
Pfam Domains
Protein Families
HSP70

Protein Analysis

85

Amino Acids

9.06

Weight (kDa)

6.7

Isoelectric Point (pI)

22.26

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 11 - 74 3.2e-27 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 244
AccB7I CCANNNNNTGG 1 cut(s) 35
AciI CCGC 1 cut(s) 177
AcoI YGGCCR 1 cut(s) 85
AfaI GTAC 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 35
AjnI CCWGG 1 cut(s) 111
AoxI GGCC 1 cut(s) 85
AspS9I GGNCC 2 cut(s) 26, 233
AsuHPI GGTGA 1 cut(s) 182
AvaII GGWCC 2 cut(s) 26, 233
BccI CCATC 1 cut(s) 139
BceAI ACGGC 1 cut(s) 72
BciT130I CCWGG 1 cut(s) 113
BfaI CTAG 1 cut(s) 156
BfuAI ACCTGC 1 cut(s) 244
BisI GCNGC 1 cut(s) 177
BlsI GCNGC 1 cut(s) 178
Bme1390I CCNGG 1 cut(s) 113
Bme18I GGWCC 2 cut(s) 26, 233
BmgT120I GGNCC 2 cut(s) 26, 233
BmiI GGNNCC 1 cut(s) 27
BmrFI CCNGG 1 cut(s) 113
BmsI GCATC 1 cut(s) 163
BsaBI GATNNNNATC 1 cut(s) 38
BsaJI CCNNGG 2 cut(s) 46, 112
BsaXI ACNNNNNCTCC 2 cut(s) 176, 206
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse8I GATNNNNATC 1 cut(s) 38
BseBI CCWGG 1 cut(s) 113
BseDI CCNNGG 2 cut(s) 46, 112
BseJI GATNNNNATC 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 35
BshFI GGCC 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 35
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 96
BspACI CCGC 1 cut(s) 177
BspANI GGCC 1 cut(s) 87
BspLI GGNNCC 1 cut(s) 27
BspMI ACCTGC 1 cut(s) 244
BssECI CCNNGG 2 cut(s) 46, 112
BssMI GATC 1 cut(s) 96
BssT1I CCWWGG 1 cut(s) 46
Bst2UI CCWGG 1 cut(s) 113
Bst4CI ACNGT 1 cut(s) 214
BstDEI CTNAG 1 cut(s) 229
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 113
BstSCI CCNGG 1 cut(s) 111
BsuRI GGCC 1 cut(s) 87
BtsIMutI CAGTG 2 cut(s) 210, 253
BveI ACCTGC 1 cut(s) 244
Cfr13I GGNCC 2 cut(s) 26, 233
Csp6I GTAC 1 cut(s) 51
CviAII CATG 3 cut(s) 63, 83, 196
CviJI RGCY 4 cut(s) 5, 87, 104, 191
CviKI_1 RGCY 4 cut(s) 5, 87, 104, 191
CviQI GTAC 1 cut(s) 51
DdeI CTNAG 1 cut(s) 229
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
EaeI YGGCCR 1 cut(s) 85
Eco130I CCWWGG 1 cut(s) 46
Eco47I GGWCC 2 cut(s) 26, 233
EcoO109I RGGNCCY 1 cut(s) 233
EcoRII CCWGG 1 cut(s) 111
EcoT14I CCWWGG 1 cut(s) 46
ErhI CCWWGG 1 cut(s) 46
FaeI CATG 3 cut(s) 66, 86, 199
FaiI YATR 6 cut(s) 8, 64, 84, 101, 138, 197
FatI CATG 3 cut(s) 62, 82, 195
Fnu4HI GCNGC 1 cut(s) 177
Fsp4HI GCNGC 1 cut(s) 177
FspBI CTAG 1 cut(s) 156
GluI GCNGC 1 cut(s) 177
HaeIII GGCC 1 cut(s) 87
Hin1II CATG 3 cut(s) 66, 86, 199
HphI GGTGA 1 cut(s) 182
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4IV ACGT 1 cut(s) 160
HpyCH4V TGCA 3 cut(s) 14, 239, 253
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 229
HpySE526I ACGT 1 cut(s) 160
Hsp92II CATG 3 cut(s) 66, 86, 199
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 5 cut(s) 42, 61, 98, 125, 249
LweI GCATC 1 cut(s) 163
MaeI CTAG 1 cut(s) 156
MaeII ACGT 1 cut(s) 160
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MluCI AATT 1 cut(s) 165
MnlI CCTC 2 cut(s) 16, 202
MseI TTAA 1 cut(s) 164
MslI CAYNNNNRTG 1 cut(s) 87
MspR9I CCNGG 1 cut(s) 113
MvaI CCWGG 1 cut(s) 113
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 1 cut(s) 96
NlaIII CATG 3 cut(s) 66, 86, 199
NlaIV GGNNCC 1 cut(s) 27
PflMI CCANNNNNTGG 1 cut(s) 35
PkrI GCNGC 1 cut(s) 178
PpuMI RGGWCCY 1 cut(s) 233
Psp5II RGGWCCY 1 cut(s) 233
Psp6I CCWGG 1 cut(s) 111
PspGI CCWGG 1 cut(s) 111
PspN4I GGNNCC 1 cut(s) 27
PspPI GGNCC 2 cut(s) 26, 233
PspPPI RGGWCCY 1 cut(s) 233
RsaI GTAC 1 cut(s) 52
RsaNI GTAC 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 87
SaqAI TTAA 1 cut(s) 164
SatI GCNGC 1 cut(s) 177
Sau3AI GATC 1 cut(s) 96
Sau96I GGNCC 2 cut(s) 26, 233
ScrFI CCNGG 1 cut(s) 113
SetI ASST 5 cut(s) 48, 59, 163, 238, 250
SfaNI GCATC 1 cut(s) 163
SinI GGWCC 2 cut(s) 26, 233
SmiMI CAYNNNNRTG 1 cut(s) 87
Sse9I AATT 1 cut(s) 165
SsiI CCGC 1 cut(s) 177
SspMI CTAG 1 cut(s) 156
StyD4I CCNGG 1 cut(s) 111
StyI CCWWGG 1 cut(s) 46
TaaI ACNGT 1 cut(s) 214
TaiI ACGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 42
TasI AATT 1 cut(s) 165
TauI GCSGC 1 cut(s) 179
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 217
TspDTI ATGAA 3 cut(s) 51, 212, 239
TspRI CASTG 1 cut(s) 217
Van91I CCANNNNNTGG 1 cut(s) 35
VpaK11BI GGWCC 2 cut(s) 26, 233
XspI CTAG 1 cut(s) 156
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.