Rh6BG022500
HSP70 Family

Heat shock cognate 70 kDa protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0001841
Physical Location & Seq
Forward (+)
3333887 .. 3334324
438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG022500.1

Sequence Viewer

Length: 288 bp
ATGGCATTGGTGGCTGAGAAAGCCAAAGGTGAGGGTCCAGCAATTGGTATCGACCTCGGAACAACATATTCATGTGTTGGTGTTTGGCAACATGATCGGGTCGAGATCATAGCCAATGACCAAGGCAACAGAACAACACCGTCTTATGTTGCTTTCACTTACACATGGCGTTTGATAGGTGATGCTGCCAAGAACCAGGCCGTCATGAACCCTATTAATACTGTTTTTGATGCAAAACTTTTGATTGGTAGGAGATTCAGTGATTCATGTTTTAGAAGTGACACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 ko04010 ko04141 ko04144 ko04213 ko04612 ko04915 ko05134 ko05145 ko05162 ko05164 ko05169 map03040 map04010 map04141 map04144 map04213 map04612 map04915 map05134 map05145 map05162 map05164 map05169
Pfam Domains
Protein Families
HSP70

Protein Analysis

95

Amino Acids

10.43

Weight (kDa)

6.54

Isoelectric Point (pI)

24.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HSP70 PF00012 14 - 94 8.1e-33 Hsp70 protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 44
AjnI CCWGG 1 cut(s) 195
AoxI GGCC 1 cut(s) 198
ApeKI GCWGC 1 cut(s) 185
AseI ATTAAT 1 cut(s) 216
AspS9I GGNCC 1 cut(s) 35
AsuHPI GGTGA 2 cut(s) 41, 191
AvaII GGWCC 1 cut(s) 35
BbvI GCAGC 1 cut(s) 172
BceAI ACGGC 1 cut(s) 185
BcgI CGANNNNNNTGC 2 cut(s) 77, 111
BciT130I CCWGG 1 cut(s) 197
BisI GCNGC 1 cut(s) 186
BlsI GCNGC 1 cut(s) 187
Bme1390I CCNGG 1 cut(s) 197
Bme18I GGWCC 1 cut(s) 35
BmgT120I GGNCC 1 cut(s) 35
BmiI GGNNCC 1 cut(s) 36
BmrFI CCNGG 1 cut(s) 197
BmsI GCATC 2 cut(s) 172, 220
BsaJI CCNNGG 2 cut(s) 55, 121
BsaXI ACNNNNNCTCC 2 cut(s) 244, 274
Bsc4I CCNNNNNNNGG 1 cut(s) 44
BseBI CCWGG 1 cut(s) 197
BseDI CCNNGG 2 cut(s) 55, 121
BseLI CCNNNNNNNGG 1 cut(s) 44
BseMII CTCAG 1 cut(s) 6
BseXI GCAGC 1 cut(s) 172
BshFI GGCC 1 cut(s) 200
BslI CCNNNNNNNGG 1 cut(s) 44
BsnI GGCC 1 cut(s) 200
Bsp143I GATC 2 cut(s) 94, 105
BspANI GGCC 1 cut(s) 200
BspCNI CTCAG 1 cut(s) 7
BspHI TCATGA 1 cut(s) 204
BspLI GGNNCC 1 cut(s) 36
BssECI CCNNGG 2 cut(s) 55, 121
BssMI GATC 2 cut(s) 94, 105
BssT1I CCWWGG 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 197
Bst4CI ACNGT 2 cut(s) 141, 223
BstDEI CTNAG 1 cut(s) 15
BstKTI GATC 2 cut(s) 97, 108
BstMBI GATC 2 cut(s) 94, 105
BstMWI GCNNNNNNNGC 2 cut(s) 11, 20
BstNI CCWGG 1 cut(s) 197
BstSCI CCNGG 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 172
BsuRI GGCC 1 cut(s) 200
BtsIMutI CAGTG 1 cut(s) 265
CciI TCATGA 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 35
CviAII CATG 6 cut(s) 72, 92, 165, 205, 267, 285
CviJI RGCY 4 cut(s) 14, 23, 113, 200
CviKI_1 RGCY 4 cut(s) 14, 23, 113, 200
DdeI CTNAG 1 cut(s) 15
DpnI GATC 2 cut(s) 96, 107
DpnII GATC 2 cut(s) 94, 105
Eco130I CCWWGG 1 cut(s) 121
Eco47I GGWCC 1 cut(s) 35
EcoRII CCWGG 1 cut(s) 195
EcoT14I CCWWGG 1 cut(s) 121
ErhI CCWWGG 1 cut(s) 121
FaeI CATG 6 cut(s) 75, 95, 168, 208, 270, 288
FaiI YATR 9 cut(s) 67, 73, 93, 110, 147, 166, 206, 268, 286
FatI CATG 6 cut(s) 71, 91, 164, 204, 266, 284
Fnu4HI GCNGC 1 cut(s) 186
Fsp4HI GCNGC 1 cut(s) 186
GluI GCNGC 1 cut(s) 186
HaeIII GGCC 1 cut(s) 200
Hin1II CATG 6 cut(s) 75, 95, 168, 208, 270, 288
HinfI GANTC 2 cut(s) 255, 263
HphI GGTGA 2 cut(s) 41, 191
Hpy188I TCNGA 1 cut(s) 59
Hpy188III TCNNGA 2 cut(s) 103, 205
HpyCH4III ACNGT 2 cut(s) 141, 223
HpyCH4V TGCA 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 20
HpyF3I CTNAG 1 cut(s) 15
Hsp92II CATG 6 cut(s) 75, 95, 168, 208, 270, 288
Kzo9I GATC 2 cut(s) 94, 105
LpnPI CCDG 3 cut(s) 51, 182, 209
Lsp1109I GCAGC 1 cut(s) 172
LweI GCATC 2 cut(s) 172, 220
MaeIII GTNAC 1 cut(s) 278
MalI GATC 2 cut(s) 96, 107
MboI GATC 2 cut(s) 94, 105
MfeI CAATTG 1 cut(s) 42
MluCI AATT 1 cut(s) 42
MnlI CCTC 2 cut(s) 25, 65
MseI TTAA 1 cut(s) 216
MslI CAYNNNNRTG 1 cut(s) 70
MspR9I CCNGG 1 cut(s) 197
MunI CAATTG 1 cut(s) 42
MvaI CCWGG 1 cut(s) 197
MwoI GCNNNNNNNGC 2 cut(s) 11, 20
NdeII GATC 2 cut(s) 94, 105
NlaIII CATG 6 cut(s) 75, 95, 168, 208, 270, 288
NlaIV GGNNCC 1 cut(s) 36
NmuCI GTSAC 1 cut(s) 278
PagI TCATGA 1 cut(s) 204
PfeI GAWTC 2 cut(s) 255, 263
PflMI CCANNNNNTGG 1 cut(s) 44
PkrI GCNGC 1 cut(s) 187
PshBI ATTAAT 1 cut(s) 216
Psp6I CCWGG 1 cut(s) 195
PspGI CCWGG 1 cut(s) 195
PspN4I GGNNCC 1 cut(s) 36
PspPI GGNCC 1 cut(s) 35
RseI CAYNNNNRTG 1 cut(s) 70
SaqAI TTAA 1 cut(s) 216
SatI GCNGC 1 cut(s) 186
Sau3AI GATC 2 cut(s) 94, 105
Sau96I GGNCC 1 cut(s) 35
ScrFI CCNGG 1 cut(s) 197
SetI ASST 3 cut(s) 31, 57, 181
SfaNI GCATC 2 cut(s) 172, 220
SinI GGWCC 1 cut(s) 35
SmiMI CAYNNNNRTG 1 cut(s) 70
Sse9I AATT 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 195
StyI CCWWGG 1 cut(s) 121
TaaI ACNGT 2 cut(s) 141, 223
TaqI TCGA 2 cut(s) 51, 102
TasI AATT 1 cut(s) 42
TfiI GAWTC 2 cut(s) 255, 263
Tru1I TTAA 1 cut(s) 216
Tru9I TTAA 1 cut(s) 216
TscAI CASTG 1 cut(s) 265
TseFI GTSAC 1 cut(s) 278
TseI GCWGC 1 cut(s) 185
Tsp45I GTSAC 1 cut(s) 278
TspDTI ATGAA 3 cut(s) 60, 221, 255
TspRI CASTG 1 cut(s) 265
Van91I CCANNNNNTGG 1 cut(s) 44
VpaK11BI GGWCC 1 cut(s) 35
VspI ATTAAT 1 cut(s) 216
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.