Rmu_ssc0000213.1_g000013

DNA repair protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000213.1
Physical Location & Seq
Forward (+)
58593 .. 59971
1379 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000213.1_g000013.1.cds

Sequence Viewer

Length: 291 bp
atggatatgggtggtggaaattgggacagagaaacaagtattccagaaacagcggaagttgcagtgcctatggctcatttccctgcaagtcaggcaaccgaaacaggcatagccaatgctccacctatctccggagcacctaattcaggtcccctgaatatgtttccgcaggaagcactgtccggtgctggtgctggcgcacttggatccctcgacttccttagaaacaatcatcagaaaagtgttcattgggattggacattcaccattttcaactctgccatcgactag

Protein Analysis

96

Amino Acids

10.1

Weight (kDa)

4.52

Isoelectric Point (pI)

28.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 131
AciI CCGC 2 cut(s) 53, 167
AclWI GGATC 2 cut(s) 201, 214
AfiI CCNNNNNNNGG 2 cut(s) 131, 146
AgsI TTSAA 1 cut(s) 274
Alw21I GWGCWC 1 cut(s) 139
AlwI GGATC 2 cut(s) 201, 214
Aor13HI TCCGGA 1 cut(s) 131
AspLEI GCGC 1 cut(s) 200
AspS9I GGNCC 1 cut(s) 149
AsuHPI GGTGA 1 cut(s) 256
AvaII GGWCC 1 cut(s) 149
BamHI GGATCC 1 cut(s) 206
Bbv12I GWGCWC 1 cut(s) 139
BccI CCATC 1 cut(s) 290
BfaI CTAG 1 cut(s) 289
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 149
BmiI GGNNCC 2 cut(s) 151, 208
BsaWI WCCGGW 2 cut(s) 131, 182
Bsc4I CCNNNNNNNGG 2 cut(s) 131, 146
BseAI TCCGGA 1 cut(s) 131
BseLI CCNNNNNNNGG 2 cut(s) 131, 146
BsiHKAI GWGCWC 1 cut(s) 139
BsiSI CCGG 2 cut(s) 132, 183
BslFI GGGAC 2 cut(s) 38, 135
BslI CCNNNNNNNGG 2 cut(s) 131, 146
BsmFI GGGAC 2 cut(s) 38, 135
Bsp1286I GDGCHC 1 cut(s) 139
Bsp13I TCCGGA 1 cut(s) 131
Bsp143I GATC 1 cut(s) 206
BspACI CCGC 2 cut(s) 53, 167
BspEI TCCGGA 1 cut(s) 131
BspLI GGNNCC 2 cut(s) 151, 208
BspPI GGATC 2 cut(s) 201, 214
BssMI GATC 1 cut(s) 206
Bst4CI ACNGT 1 cut(s) 180
BstC8I GCNNGC 1 cut(s) 196
BstDEI CTNAG 1 cut(s) 221
BstENI CCTNNNNNAGG 1 cut(s) 144
BstHHI GCGC 1 cut(s) 200
BstKTI GATC 1 cut(s) 209
BstMBI GATC 1 cut(s) 206
BstMWI GCNNNNNNNGC 2 cut(s) 59, 92
BstX2I RGATCY 1 cut(s) 206
BstYI RGATCY 1 cut(s) 206
BtsI GCAGTG 1 cut(s) 69
BtsIMutI CAGTG 2 cut(s) 69, 176
Cac8I GCNNGC 1 cut(s) 196
CfoI GCGC 1 cut(s) 200
Cfr13I GGNCC 1 cut(s) 149
CviJI RGCY 2 cut(s) 74, 113
CviKI_1 RGCY 2 cut(s) 74, 113
DdeI CTNAG 1 cut(s) 221
DpnI GATC 1 cut(s) 208
DpnII GATC 1 cut(s) 206
Eco47I GGWCC 1 cut(s) 149
EcoNI CCTNNNNNAGG 1 cut(s) 144
EcoO109I RGGNCCY 1 cut(s) 149
FaiI YATR 4 cut(s) 8, 71, 110, 161
FaqI GGGAC 2 cut(s) 38, 135
FspBI CTAG 1 cut(s) 289
GlaI GCGC 1 cut(s) 199
HapII CCGG 2 cut(s) 132, 183
HhaI GCGC 1 cut(s) 200
Hin6I GCGC 1 cut(s) 198
HinP1I GCGC 1 cut(s) 198
HpaII CCGG 2 cut(s) 132, 183
HphI GGTGA 1 cut(s) 256
Hpy188I TCNGA 1 cut(s) 237
Hpy188III TCNNGA 2 cut(s) 44, 132
HpyCH4III ACNGT 1 cut(s) 180
HpyCH4V TGCA 2 cut(s) 62, 86
HpyF10VI GCNNNNNNNGC 2 cut(s) 59, 92
HpyF3I CTNAG 1 cut(s) 221
HspAI GCGC 1 cut(s) 198
Kpn2I TCCGGA 1 cut(s) 131
Kzo9I GATC 1 cut(s) 206
LmnI GCTCC 2 cut(s) 124, 134
MaeI CTAG 1 cut(s) 289
MalI GATC 1 cut(s) 208
MboI GATC 1 cut(s) 206
MflI RGATCY 1 cut(s) 206
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 2 cut(s) 19, 142
MnlI CCTC 1 cut(s) 221
MroI TCCGGA 1 cut(s) 131
MspA1I CMGCKG 1 cut(s) 53
MspI CCGG 2 cut(s) 132, 183
MwoI GCNNNNNNNGC 2 cut(s) 59, 92
NdeII GATC 1 cut(s) 206
NlaIV GGNNCC 2 cut(s) 151, 208
PpuMI RGGWCCY 1 cut(s) 149
Psp5II RGGWCCY 1 cut(s) 149
PspN4I GGNNCC 2 cut(s) 151, 208
PspPI GGNCC 1 cut(s) 149
PspPPI RGGWCCY 1 cut(s) 149
PsuI RGATCY 1 cut(s) 206
Sau3AI GATC 1 cut(s) 206
Sau96I GGNCC 1 cut(s) 149
SduI GDGCHC 1 cut(s) 139
SetI ASST 3 cut(s) 127, 142, 151
SinI GGWCC 1 cut(s) 149
Sse9I AATT 2 cut(s) 19, 142
SsiI CCGC 2 cut(s) 53, 167
SspMI CTAG 1 cut(s) 289
TaaI ACNGT 1 cut(s) 180
TaqI TCGA 2 cut(s) 213, 285
TasI AATT 2 cut(s) 19, 142
TscAI CASTG 2 cut(s) 69, 183
TspDTI ATGAA 1 cut(s) 236
TspRI CASTG 2 cut(s) 69, 183
VpaK11BI GGWCC 1 cut(s) 149
XagI CCTNNNNNAGG 1 cut(s) 144
XspI CTAG 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.