Basic Information

Type: gene

Biological Identity

Species

rosa_rugosa

Chromosome

GWHBQTZ00000002

Orthogroup ID

OG0001350

Physical Location & Seq

Genomic Coordinates Reverse (-)

33474629 .. 33475175

Gene Structure 547 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rorug02G0300100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 171 bp

ATGTTTGACCGAAAGCTGACAGAGGAAGACTTGGAAGTGGCAATGAATGACATCAAAGGAAGAAACAGAGGAGTAGCATCAGATGAAGAGCTGAGGGAGGAAGACTTTGTAATCCAACTTTTGGAGATTGGCACCAGAAAACCACCCAAGAACGGCGAAAAGAAGAAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0005488 GO:0005515 GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0031593 GO:0032182 GO:0043130 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044464 GO:0044877 GO:0070628 GO:0140030

KEGG Pathways

Metabolic & Signaling

ko03420 ko04141 map03420 map04141

Pfam Domains

Protein Families

UBA XPC-binding ubiquitin

Protein Analysis

56

Amino Acids

6.52

Weight (kDa)

5.12

Isoelectric Point (pI)

36.68

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0001350)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G16190 AT1G16190 AT1G79650 AT1G79650 AT1G79650 AT1G79650
fragaria_vesca	FvH4_6g28060
malus_domestica	MD09G1229800.v1.1 MD17G1228500.v1.1
prunus_persica	Prupe.3G105900_v2.0.a1
pyrus_communis	pycom09g14830 pycom17g23110
rosa_chinensis	RchiOBHm_Chr1g0327471 RchiOBHm_Chr2g0131831
rosa_laevigata	RLG00000019212 RLG00000021652 RLG00000030713
rosa_multiflora	Rmu_sc0002700.1_g000003 Rmu_sc0003731.1_g000013 Rmu_ssc0000213.1_g000013
rosa_roxburghii	Rroxscaffold_1G00054010 Rroxscaffold_2G00112590 Rroxscaffold_2G00127890 Rroxscaffold_4G00302760 Rroxscaffold_5G00338170 Rroxscaffold_5G00341450 Rroxscaffold_5G00371080 Rroxscaffold_6G00390940 Rroxscaffold_6G00420830 Rroxscaffold_7G00196290 Rroxscaffold_7G00209730
rosa_rugosa	Rorug02G0107700 Rorug02G0299900 Rorug02G0300000 Rorug02G0300100 Rorug02G0476100
rosa_samantha	Rh1AG084200 Rh1CG081900 Rh1CG257900 Rh1DG088500 Rh2AG352100 Rh2BG359300 Rh2CG337700 Rh2DG376600 Rh4BG187800 Rh5AG270100 Rh5CG354000 Rh5CG379700 Rh6AG057900 Rh7AG341300 Rh7CG359200
rosa_wichuraiana	Rw1G006620 Rw2G028620

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	131
AccB7I	CCANNNNNTGG	1 cut(s)	121
AfiI	CCNNNNNNNGG	2 cut(s)	121, 152
AluBI	AGCT	2 cut(s)	16, 91
AluI	AGCT	2 cut(s)	16, 91
BanI	GGYRCC	1 cut(s)	131
BbsI	GAAGAC	2 cut(s)	33, 108
BbvCI	CCTCAGC	1 cut(s)	92
BceAI	ACGGC	1 cut(s)	169
BmiI	GGNNCC	1 cut(s)	133
BmsI	GCATC	1 cut(s)	86
BpiI	GAAGAC	2 cut(s)	33, 108
Bpu10I	CCTNAGC	1 cut(s)	92
Bsc4I	CCNNNNNNNGG	2 cut(s)	121, 152
Bse3DI	GCAATG	1 cut(s)	48
BseLI	CCNNNNNNNGG	2 cut(s)	121, 152
BseMI	GCAATG	1 cut(s)	48
BseMII	CTCAG	1 cut(s)	83
BseRI	GAGGAG	1 cut(s)	84
BshNI	GGYRCC	1 cut(s)	131
BslI	CCNNNNNNNGG	2 cut(s)	121, 152
BspCNI	CTCAG	1 cut(s)	84
BspLI	GGNNCC	1 cut(s)	133
BspQI	GCTCTTC	1 cut(s)	81
BspT107I	GGYRCC	1 cut(s)	131
BsrDI	GCAATG	1 cut(s)	48
Bst6I	CTCTTC	1 cut(s)	81
BstDEI	CTNAG	1 cut(s)	92
BstV2I	GAAGAC	2 cut(s)	33, 108
CviJI	RGCY	2 cut(s)	16, 91
CviKI_1	RGCY	2 cut(s)	16, 91
DdeI	CTNAG	1 cut(s)	92
Eam1104I	CTCTTC	1 cut(s)	81
EarI	CTCTTC	1 cut(s)	81
Hpy188I	TCNGA	1 cut(s)	82
HpyF3I	CTNAG	1 cut(s)	92
LguI	GCTCTTC	1 cut(s)	81
LpnPI	CCDG	1 cut(s)	148
LweI	GCATC	1 cut(s)	86
MboII	GAAGA	4 cut(s)	38, 72, 98, 113
MmeI	TCCRAC	1 cut(s)	139
MnlI	CCTC	4 cut(s)	16, 62, 87, 91
NlaIV	GGNNCC	1 cut(s)	133
PciSI	GCTCTTC	1 cut(s)	81
PflMI	CCANNNNNTGG	1 cut(s)	121
PspN4I	GGNNCC	1 cut(s)	133
SapI	GCTCTTC	1 cut(s)	81
SetI	ASST	2 cut(s)	18, 93
SfaNI	GCATC	1 cut(s)	86
SgeI	CNNG	3 cut(s)	43, 147, 160
TaqII	GACCGA	1 cut(s)	24
TspDTI	ATGAA	2 cut(s)	59, 99
Van91I	CCANNNNNTGG	1 cut(s)	121

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.