Rh1CG257900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0001350
Physical Location & Seq
Reverse (-)
52248924 .. 52251891
2968 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG257900.1

Sequence Viewer

Length: 201 bp
ATGAACTTTTTCATTGGCATATGTGGGTTTTCTAGTTCGGAATTGGAAGAAGCTATTGTGGGCATTCTTCTTCAGCAAAACATTCAGGCCATTGTTGCTATCGTTTTGTTCACGATTAGCAGATTTTTCTTATGGACCTTAGTGAATCATCATTGTGAGTTTGTTGATGATTTATTGAAAGATAAGCTGCATAACATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.57

Weight (kDa)

4.97

Isoelectric Point (pI)

39.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 56
AgsI TTSAA 1 cut(s) 178
AluBI AGCT 2 cut(s) 53, 187
AluI AGCT 2 cut(s) 53, 187
AoxI GGCC 1 cut(s) 87
ApeKI GCWGC 1 cut(s) 187
Asp700I GAANNNNTTC 1 cut(s) 8
AspS9I GGNCC 1 cut(s) 135
AvaII GGWCC 1 cut(s) 135
BbvI GCAGC 1 cut(s) 174
BfaI CTAG 2 cut(s) 33, 199
BisI GCNGC 1 cut(s) 188
BlsI GCNGC 1 cut(s) 189
Bme18I GGWCC 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 135
BseXI GCAGC 1 cut(s) 174
BshFI GGCC 1 cut(s) 89
BsmI GAATGC 1 cut(s) 63
BsnI GGCC 1 cut(s) 89
BspANI GGCC 1 cut(s) 89
BstDEI CTNAG 1 cut(s) 139
BstMWI GCNNNNNNNGC 1 cut(s) 95
BstV1I GCAGC 1 cut(s) 174
BsuRI GGCC 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 135
CviJI RGCY 3 cut(s) 53, 89, 187
CviKI_1 RGCY 3 cut(s) 53, 89, 187
DdeI CTNAG 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 135
Eco57I CTGAAG 1 cut(s) 56
FaiI YATR 4 cut(s) 20, 22, 133, 192
FauNDI CATATG 1 cut(s) 20
Fnu4HI GCNGC 1 cut(s) 188
Fsp4HI GCNGC 1 cut(s) 188
FspBI CTAG 2 cut(s) 33, 199
GluI GCNGC 1 cut(s) 188
HaeIII GGCC 1 cut(s) 89
HinfI GANTC 1 cut(s) 145
Hpy166II GTNNAC 1 cut(s) 111
Hpy188I TCNGA 1 cut(s) 40
Hpy188III TCNNGA 1 cut(s) 112
Hpy8I GTNNAC 1 cut(s) 111
HpyCH4V TGCA 1 cut(s) 190
HpyF10VI GCNNNNNNNGC 1 cut(s) 95
HpyF3I CTNAG 1 cut(s) 139
LpnPI CCDG 1 cut(s) 71
Lsp1109I GCAGC 1 cut(s) 174
MaeI CTAG 2 cut(s) 33, 199
MboII GAAGA 3 cut(s) 59, 59, 62
MluCI AATT 1 cut(s) 41
MroXI GAANNNNTTC 1 cut(s) 8
MslI CAYNNNNRTG 1 cut(s) 153
Mva1269I GAATGC 1 cut(s) 63
MwoI GCNNNNNNNGC 1 cut(s) 95
NdeI CATATG 1 cut(s) 20
PctI GAATGC 1 cut(s) 63
PdmI GAANNNNTTC 1 cut(s) 8
PfeI GAWTC 1 cut(s) 145
PkrI GCNGC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 135
RseI CAYNNNNRTG 1 cut(s) 153
SatI GCNGC 1 cut(s) 188
Sau96I GGNCC 1 cut(s) 135
SetI ASST 3 cut(s) 55, 140, 189
SgeI CNNG 3 cut(s) 45, 98, 124
SinI GGWCC 1 cut(s) 135
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 1 cut(s) 41
SspMI CTAG 2 cut(s) 33, 199
TasI AATT 1 cut(s) 41
TfiI GAWTC 1 cut(s) 145
TseI GCWGC 1 cut(s) 187
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 135
XmnI GAANNNNTTC 1 cut(s) 8
XspI CTAG 2 cut(s) 33, 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.