Rroxscaffold_3G00251470

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
OG0001072
Physical Location & Seq
Reverse (-)
45351569 .. 45352524
956 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00251470.1

Sequence Viewer

Length: 180 bp
ATGGCTCTCTTAGTCCCCGCAATCAGAATTGAGATGGCTCAAAAAGCTCTAAAAACAAGGAAGGGGCAGGAGAGGGTTTACAAGGAGTTCAATGAGAAAAAGAAGCAGAAGAAGAAGAATGAGGGTGGCTCGGCGCCCACTGATTTTGAGAAATTGGGGTCTGAAATGTTAGGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.69

Weight (kDa)

9.85

Isoelectric Point (pI)

35.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 133
AciI CCGC 1 cut(s) 18
AcyI GRCGYC 1 cut(s) 134
AgsI TTSAA 1 cut(s) 91
AluBI AGCT 1 cut(s) 47
AluI AGCT 1 cut(s) 47
AspLEI GCGC 1 cut(s) 136
BanI GGYRCC 1 cut(s) 133
BccI CCATC 1 cut(s) 28
BfoI RGCGCY 1 cut(s) 137
BmiI GGNNCC 1 cut(s) 135
BplI GAGNNNNNCTC 2 cut(s) 113, 145
BsaHI GRCGYC 1 cut(s) 134
BshNI GGYRCC 1 cut(s) 133
BspACI CCGC 1 cut(s) 18
BspLI GGNNCC 1 cut(s) 135
BspT107I GGYRCC 1 cut(s) 133
BssNI GRCGYC 1 cut(s) 134
BstACI GRCGYC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 10
BstH2I RGCGCY 1 cut(s) 137
BstHHI GCGC 1 cut(s) 136
BstMWI GCNNNNNNNGC 1 cut(s) 44
BtsIMutI CAGTG 1 cut(s) 138
CfoI GCGC 1 cut(s) 136
CspCI CAANNNNNGTGG 2 cut(s) 127, 162
CviJI RGCY 4 cut(s) 5, 38, 47, 129
CviKI_1 RGCY 4 cut(s) 5, 38, 47, 129
DdeI CTNAG 1 cut(s) 10
DinI GGCGCC 1 cut(s) 135
EgeI GGCGCC 1 cut(s) 135
EheI GGCGCC 1 cut(s) 135
FauI CCCGC 1 cut(s) 25
GlaI GCGC 1 cut(s) 135
HaeII RGCGCY 1 cut(s) 137
HhaI GCGC 1 cut(s) 136
Hin1I GRCGYC 1 cut(s) 134
Hin6I GCGC 1 cut(s) 134
HinP1I GCGC 1 cut(s) 134
Hpy166II GTNNAC 1 cut(s) 79
Hpy188I TCNGA 2 cut(s) 26, 163
Hpy8I GTNNAC 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 55
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 10
Hsp92I GRCGYC 1 cut(s) 134
HspAI GCGC 1 cut(s) 134
KasI GGCGCC 1 cut(s) 133
LpnPI CCDG 1 cut(s) 53
MboII GAAGA 3 cut(s) 121, 124, 127
MluCI AATT 3 cut(s) 27, 152, 175
Mly113I GGCGCC 1 cut(s) 134
MnlI CCTC 2 cut(s) 66, 115
MseI TTAA 1 cut(s) 178
MwoI GCNNNNNNNGC 1 cut(s) 44
NarI GGCGCC 1 cut(s) 134
NlaIV GGNNCC 1 cut(s) 135
NmeAIII GCCGAG 1 cut(s) 110
PluTI GGCGCC 1 cut(s) 137
PspN4I GGNNCC 1 cut(s) 135
SaqAI TTAA 1 cut(s) 178
SetI ASST 1 cut(s) 49
SfoI GGCGCC 1 cut(s) 135
SgeI CNNG 5 cut(s) 29, 69, 80, 94, 142
Sse9I AATT 3 cut(s) 27, 152, 175
SsiI CCGC 1 cut(s) 18
SspDI GGCGCC 1 cut(s) 133
TasI AATT 3 cut(s) 27, 152, 175
Tru1I TTAA 1 cut(s) 178
Tru9I TTAA 1 cut(s) 178
TscAI CASTG 1 cut(s) 145
TspRI CASTG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.