Rorug07G0098000

SNF2 domain-containing protein CLASSY

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
7683315 .. 7683470
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0098000.1

Sequence Viewer

Length: 156 bp
ATGTTCAAGACTCTTTTGAGGCATCAGCTCGGTAATCTGCAAAGCAAGATGCTTCCATCTTATTTCACAATGGTGGGGATTTGTTGTGCAATATCAGTAGCTTTATTTGGGTATTTGTATCCATGGAACTCTTCCACAATAGCAGACAAGTACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

51

Amino Acids

5.82

Weight (kDa)

9.14

Isoelectric Point (pI)

41.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4149 PF13664 1 - 40 1.5e-07 Domain of unknown function (DUF4149)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 152
AgsI TTSAA 1 cut(s) 7
AleI CACNNNNGTG 1 cut(s) 71
AluBI AGCT 2 cut(s) 28, 101
AluI AGCT 2 cut(s) 28, 101
BccI CCATC 1 cut(s) 64
BciVI GTATCC 1 cut(s) 129
BfaI CTAG 1 cut(s) 154
BfuI GTATCC 1 cut(s) 129
BmcAI AGTACT 1 cut(s) 152
BmsI GCATC 2 cut(s) 31, 39
BsaJI CCNNGG 1 cut(s) 122
BseDI CCNNGG 1 cut(s) 122
Bsp19I CCATGG 1 cut(s) 122
BssECI CCNNGG 1 cut(s) 122
BssT1I CCWWGG 1 cut(s) 122
Bst6I CTCTTC 1 cut(s) 136
BstDSI CCRYGG 1 cut(s) 122
BsuI GTATCC 1 cut(s) 129
BtgI CCRYGG 1 cut(s) 122
Csp6I GTAC 1 cut(s) 151
CviAII CATG 1 cut(s) 123
CviJI RGCY 2 cut(s) 28, 101
CviKI_1 RGCY 2 cut(s) 28, 101
CviQI GTAC 1 cut(s) 151
Eam1104I CTCTTC 1 cut(s) 136
EarI CTCTTC 1 cut(s) 136
Eco130I CCWWGG 1 cut(s) 122
EcoT14I CCWWGG 1 cut(s) 122
ErhI CCWWGG 1 cut(s) 122
FaeI CATG 1 cut(s) 126
FaiI YATR 1 cut(s) 124
FatI CATG 1 cut(s) 122
FspBI CTAG 1 cut(s) 154
Hin1II CATG 1 cut(s) 126
HinfI GANTC 1 cut(s) 10
Hpy188III TCNNGA 1 cut(s) 7
HpyCH4V TGCA 2 cut(s) 40, 89
Hsp92II CATG 1 cut(s) 126
LweI GCATC 2 cut(s) 31, 39
MaeI CTAG 1 cut(s) 154
MboII GAAGA 1 cut(s) 123
MlyI GAGTC 1 cut(s) 4
MnlI CCTC 1 cut(s) 12
MslI CAYNNNNRTG 1 cut(s) 71
NcoI CCATGG 1 cut(s) 122
NlaIII CATG 1 cut(s) 126
OliI CACNNNNGTG 1 cut(s) 71
PleI GAGTC 1 cut(s) 4
PpsI GAGTC 1 cut(s) 4
RsaI GTAC 1 cut(s) 152
RsaNI GTAC 1 cut(s) 151
RseI CAYNNNNRTG 1 cut(s) 71
ScaI AGTACT 1 cut(s) 152
SchI GAGTC 1 cut(s) 4
SetI ASST 2 cut(s) 30, 103
SfaNI GCATC 2 cut(s) 31, 39
SgeI CNNG 4 cut(s) 19, 41, 58, 135
SmiMI CAYNNNNRTG 1 cut(s) 71
SspMI CTAG 1 cut(s) 154
StyI CCWWGG 1 cut(s) 122
TatI WGTACW 1 cut(s) 150
XspI CTAG 1 cut(s) 154
ZrmI AGTACT 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.