Rh4CG451900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
OG0000970
Physical Location & Seq
Forward (+)
68525584 .. 68531110
5527 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG451900.1

Sequence Viewer

Length: 207 bp
ATGAGAAAGGGAATTTGGGGAGGCGTGATGTGGAACAGCTCTTCAAACCTTGGTGCTCATTATAGTTCTTTACAGAACCAACTGGAACAAGGAGGGTTTTATGTGAGTTCATATATAAAACCTATAGTCAGATCCTCTACAAGATGGCTTGGAGGCAAATACTATTCAACTCACATGAGCATTTGGACCGCATTCAACAACTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.82

Weight (kDa)

9.99

Isoelectric Point (pI)

57.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 189
AclWI GGATC 1 cut(s) 126
AcsI RAATTY 1 cut(s) 12
AgsI TTSAA 3 cut(s) 45, 168, 196
AjuI GAANNNNNNNTTGG 1 cut(s) 30
AluBI AGCT 1 cut(s) 39
AluI AGCT 1 cut(s) 39
Alw21I GWGCWC 1 cut(s) 58
AlwI GGATC 1 cut(s) 126
ApoI RAATTY 1 cut(s) 12
AspS9I GGNCC 1 cut(s) 186
AvaII GGWCC 1 cut(s) 186
Bbv12I GWGCWC 1 cut(s) 58
BccI CCATC 1 cut(s) 138
BfmI CTRYAG 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 186
BmgT120I GGNCC 1 cut(s) 186
BsaJI CCNNGG 1 cut(s) 49
Bse1I ACTGG 2 cut(s) 87, 206
BseDI CCNNGG 1 cut(s) 49
BseNI ACTGG 2 cut(s) 87, 206
BsiHKAI GWGCWC 1 cut(s) 58
BsmI GAATGC 1 cut(s) 191
Bsp1286I GDGCHC 1 cut(s) 58
Bsp143I GATC 1 cut(s) 131
BspACI CCGC 1 cut(s) 189
BspPI GGATC 1 cut(s) 126
BspQI GCTCTTC 1 cut(s) 46
BsrI ACTGG 2 cut(s) 87, 206
BssECI CCNNGG 1 cut(s) 49
BssMI GATC 1 cut(s) 131
BssT1I CCWWGG 1 cut(s) 49
Bst6I CTCTTC 1 cut(s) 46
BstKTI GATC 1 cut(s) 134
BstMBI GATC 1 cut(s) 131
BstSFI CTRYAG 1 cut(s) 123
BstX2I RGATCY 1 cut(s) 131
BstYI RGATCY 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 186
CviAII CATG 1 cut(s) 175
CviJI RGCY 2 cut(s) 39, 148
CviKI_1 RGCY 2 cut(s) 39, 148
DpnI GATC 1 cut(s) 133
DpnII GATC 1 cut(s) 131
Eam1104I CTCTTC 1 cut(s) 46
EarI CTCTTC 1 cut(s) 46
Eco130I CCWWGG 1 cut(s) 49
Eco47I GGWCC 1 cut(s) 186
EcoT14I CCWWGG 1 cut(s) 49
ErhI CCWWGG 1 cut(s) 49
FaeI CATG 1 cut(s) 178
FaiI YATR 7 cut(s) 63, 102, 112, 114, 116, 125, 176
FatI CATG 1 cut(s) 174
Hin1II CATG 1 cut(s) 178
Hpy188I TCNGA 1 cut(s) 131
Hsp92II CATG 1 cut(s) 178
Kzo9I GATC 1 cut(s) 131
LguI GCTCTTC 1 cut(s) 46
LpnPI CCDG 2 cut(s) 68, 187
MalI GATC 1 cut(s) 133
MboI GATC 1 cut(s) 131
MboII GAAGA 1 cut(s) 33
MflI RGATCY 1 cut(s) 131
MhlI GDGCHC 1 cut(s) 58
MluCI AATT 1 cut(s) 12
MnlI CCTC 4 cut(s) 14, 86, 145, 146
Mva1269I GAATGC 1 cut(s) 191
NdeII GATC 1 cut(s) 131
NlaIII CATG 1 cut(s) 178
PciSI GCTCTTC 1 cut(s) 46
PctI GAATGC 1 cut(s) 191
PspPI GGNCC 1 cut(s) 186
PsuI RGATCY 1 cut(s) 131
SapI GCTCTTC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 186
SduI GDGCHC 1 cut(s) 58
SetI ASST 3 cut(s) 41, 51, 124
SfcI CTRYAG 1 cut(s) 123
SgeI CNNG 7 cut(s) 37, 62, 95, 101, 153, 161, 187
SinI GGWCC 1 cut(s) 186
Sse9I AATT 1 cut(s) 12
SsiI CCGC 1 cut(s) 189
StyI CCWWGG 1 cut(s) 49
TasI AATT 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 99
VpaK11BI GGWCC 1 cut(s) 186
XapI RAATTY 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.