MD01G1044800.v1.1

Mitochondrial protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Forward (+)
14433889 .. 14439437
5549 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1044800.v1.1.491

Sequence Viewer

Length: 198 bp
ATGAATCATATTCATCATTCAAGGATCAAGCATTTGGAAACTGACTTTCATTTTGTTCGAGAATGGGTGCAAAAGGGTGATCTTGATGTTCAATATGTGCCTACACAGGATCAAGTGGCTGACATCCTTACAAAAGGACTTCATGGTCTTGATTTTCTCAAACATTGTCACAATCTTAATCTAGCACATTCTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

66

Amino Acids

7.59

Weight (kDa)

6.47

Isoelectric Point (pI)

18.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 144
AclWI GGATC 2 cut(s) 32, 117
AgsI TTSAA 2 cut(s) 21, 92
AlwI GGATC 2 cut(s) 32, 117
ArsI GACNNNNNNTTYG 2 cut(s) 35, 67
AsuHPI GGTGA 1 cut(s) 89
BfaI CTAG 1 cut(s) 182
BseGI GGATG 1 cut(s) 123
Bsp143I GATC 3 cut(s) 24, 79, 109
BspPI GGATC 2 cut(s) 32, 117
BssMI GATC 3 cut(s) 24, 79, 109
BstF5I GGATG 1 cut(s) 123
BstKTI GATC 3 cut(s) 27, 82, 112
BstMBI GATC 3 cut(s) 24, 79, 109
BtsCI GGATG 1 cut(s) 123
CviAII CATG 1 cut(s) 143
CviJI RGCY 1 cut(s) 119
CviKI_1 RGCY 1 cut(s) 119
DpnI GATC 3 cut(s) 26, 81, 111
DpnII GATC 3 cut(s) 24, 79, 109
DrdI GACNNNNNNGTC 1 cut(s) 144
DseDI GACNNNNNNGTC 1 cut(s) 144
FaeI CATG 1 cut(s) 146
FaiI YATR 3 cut(s) 9, 96, 144
FatI CATG 1 cut(s) 142
FokI GGATG 1 cut(s) 110
FspBI CTAG 1 cut(s) 182
Hin1II CATG 1 cut(s) 146
HinfI GANTC 1 cut(s) 4
HphI GGTGA 1 cut(s) 89
Hpy188III TCNNGA 3 cut(s) 59, 83, 149
HpyCH4V TGCA 1 cut(s) 70
Hsp92II CATG 1 cut(s) 146
Kzo9I GATC 3 cut(s) 24, 79, 109
LpnPI CCDG 2 cut(s) 92, 177
MaeI CTAG 1 cut(s) 182
MaeIII GTNAC 1 cut(s) 167
MalI GATC 3 cut(s) 26, 81, 111
MboI GATC 3 cut(s) 24, 79, 109
MseI TTAA 2 cut(s) 177, 196
NdeII GATC 3 cut(s) 24, 79, 109
NlaIII CATG 1 cut(s) 146
NmuCI GTSAC 1 cut(s) 167
PfeI GAWTC 1 cut(s) 4
SaqAI TTAA 2 cut(s) 177, 196
Sau3AI GATC 3 cut(s) 24, 79, 109
SgeI CNNG 9 cut(s) 33, 40, 71, 95, 119, 125, 155, 161, 194
SspMI CTAG 1 cut(s) 182
TaqI TCGA 1 cut(s) 58
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 177, 196
Tru9I TTAA 2 cut(s) 177, 196
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 3 cut(s) 17, 38, 131
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.