RchiOBHm_Chr1g0339121

Mitochondrial protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
30410604 .. 30411162
559 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56607

Sequence Viewer

Length: 489 bp
ATGCATCAACCTCAGGGTTTCACTGATCCTGTTCATCCTGATTATGTTTGCCACTTGAAGAAATCCTTATATGGATTGAAGCAAGCTCCTCGTGCTTGGAATGAAAAATTCACTTGCTTCCTTCCTACACTAGGTTTCAAATTCTCTAATTCTGATCCTAGTCTATTTGTGAAAATAACTGATCATGGTGTGATAGCTTTGCTATTATATGTGGATGATATTGTTATAACAGGCTCAGATAAACTTGGGATCACATCTATTATTTCTGAATTAAGTGATGTGTTTGACATGAAAGATCTTGGTCCATTGTCATTCTTTCTGGGAATTGGAATTAGGTATAAAGAGAAAGGACTTTTCTTGTCTCAGGAAAAGTATGCCAATGAGCTTATTCAGAAGGCTGGTCTAGAAACCTGTAGAGACTGCAATACACCATGTCTACCTCATGCTCAGTTGCTTAAAGATGAAGGCACAACATTGCTTATGCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

162

Amino Acids

18.14

Weight (kDa)

5.92

Isoelectric Point (pI)

20.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 1 - 146 3.3e-37 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 227
AccI GTMKAC 1 cut(s) 436
AclWI GGATC 3 cut(s) 20, 149, 257
AcsI RAATTY 2 cut(s) 107, 140
AfiI CCNNNNNNNGG 1 cut(s) 131
AgsI TTSAA 3 cut(s) 58, 79, 139
AluBI AGCT 3 cut(s) 86, 197, 385
AluI AGCT 3 cut(s) 86, 197, 385
Alw26I GTCTC 2 cut(s) 366, 411
AlwI GGATC 3 cut(s) 20, 149, 257
ApoI RAATTY 2 cut(s) 107, 140
AspS9I GGNCC 1 cut(s) 302
AvaII GGWCC 1 cut(s) 302
AxyI CCTNAGG 1 cut(s) 12
BauI CACGAG 1 cut(s) 90
BcgI CGANNNNNNTGC 2 cut(s) 71, 105
BclI TGATCA 1 cut(s) 181
BcoDI GTCTC 2 cut(s) 366, 411
BfaI CTAG 3 cut(s) 131, 159, 404
BfmI CTRYAG 1 cut(s) 412
BglII AGATCT 1 cut(s) 295
Bme18I GGWCC 1 cut(s) 302
BmgT120I GGNCC 1 cut(s) 302
BmsI GCATC 1 cut(s) 13
Bsc4I CCNNNNNNNGG 1 cut(s) 131
Bse21I CCTNAGG 1 cut(s) 12
Bse3DI GCAATG 1 cut(s) 473
BseGI GGATG 2 cut(s) 34, 220
BseLI CCNNNNNNNGG 1 cut(s) 131
BseMI GCAATG 1 cut(s) 473
BseMII CTCAG 4 cut(s) 26, 249, 377, 461
BseRI GAGGAG 1 cut(s) 78
BslI CCNNNNNNNGG 1 cut(s) 131
BsmAI GTCTC 2 cut(s) 366, 411
Bsp143I GATC 5 cut(s) 25, 154, 181, 249, 295
BspCNI CTCAG 4 cut(s) 25, 248, 376, 460
BspPI GGATC 3 cut(s) 20, 149, 257
BsrDI GCAATG 1 cut(s) 473
BssMI GATC 5 cut(s) 25, 154, 181, 249, 295
BssSI CACGAG 1 cut(s) 90
Bst2BI CACGAG 1 cut(s) 90
BstC8I GCNNGC 1 cut(s) 84
BstDEI CTNAG 4 cut(s) 12, 235, 363, 447
BstENI CCTNNNNNAGG 1 cut(s) 129
BstF5I GGATG 2 cut(s) 34, 220
BstKTI GATC 5 cut(s) 28, 157, 184, 252, 298
BstMAI GTCTC 2 cut(s) 366, 411
BstMBI GATC 5 cut(s) 25, 154, 181, 249, 295
BstMWI GCNNNNNNNGC 1 cut(s) 92
BstSFI CTRYAG 1 cut(s) 412
BstX2I RGATCY 1 cut(s) 295
BstYI RGATCY 1 cut(s) 295
Bsu36I CCTNAGG 1 cut(s) 12
BtsCI GGATG 2 cut(s) 34, 220
BtsIMutI CAGTG 1 cut(s) 21
Cac8I GCNNGC 1 cut(s) 84
Cfr13I GGNCC 1 cut(s) 302
CviAII CATG 4 cut(s) 185, 289, 432, 443
CviJI RGCY 5 cut(s) 86, 197, 234, 385, 398
CviKI_1 RGCY 5 cut(s) 86, 197, 234, 385, 398
DdeI CTNAG 4 cut(s) 12, 235, 363, 447
DpnI GATC 5 cut(s) 27, 156, 183, 251, 297
DpnII GATC 5 cut(s) 25, 154, 181, 249, 295
Eco47I GGWCC 1 cut(s) 302
Eco81I CCTNAGG 1 cut(s) 12
EcoNI CCTNNNNNAGG 1 cut(s) 129
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 4 cut(s) 188, 292, 435, 446
FalI AAGNNNNNCTT 2 cut(s) 50, 82
FatI CATG 4 cut(s) 184, 288, 431, 442
FbaI TGATCA 1 cut(s) 181
FblI GTMKAC 1 cut(s) 436
FokI GGATG 2 cut(s) 21, 227
FspBI CTAG 3 cut(s) 131, 159, 404
Hin1II CATG 4 cut(s) 188, 292, 435, 446
Hpy166II GTNNAC 1 cut(s) 437
Hpy188I TCNGA 4 cut(s) 154, 238, 268, 393
Hpy188III TCNNGA 3 cut(s) 38, 365, 404
Hpy8I GTNNAC 1 cut(s) 437
HpyAV CCTTC 3 cut(s) 131, 388, 458
HpyCH4V TGCA 2 cut(s) 4, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 92
HpyF3I CTNAG 4 cut(s) 12, 235, 363, 447
Hsp92II CATG 4 cut(s) 188, 292, 435, 446
Ksp22I TGATCA 1 cut(s) 181
Kzo9I GATC 5 cut(s) 25, 154, 181, 249, 295
LmnI GCTCC 1 cut(s) 91
LpnPI CCDG 7 cut(s) 42, 51, 216, 305, 350, 384, 424
LweI GCATC 1 cut(s) 13
MaeI CTAG 3 cut(s) 131, 159, 404
MalI GATC 5 cut(s) 27, 156, 183, 251, 297
MboI GATC 5 cut(s) 25, 154, 181, 249, 295
MboII GAAGA 1 cut(s) 70
MflI RGATCY 1 cut(s) 295
MluCI AATT 6 cut(s) 107, 140, 148, 269, 324, 330
MnlI CCTC 3 cut(s) 21, 99, 450
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 2 cut(s) 272, 456
MwoI GCNNNNNNNGC 1 cut(s) 92
NdeII GATC 5 cut(s) 25, 154, 181, 249, 295
NlaIII CATG 4 cut(s) 188, 292, 435, 446
NsiI ATGCAT 1 cut(s) 6
PsiI TTATAA 1 cut(s) 227
PspPI GGNCC 1 cut(s) 302
PsuI RGATCY 1 cut(s) 295
SaqAI TTAA 2 cut(s) 272, 456
Sau3AI GATC 5 cut(s) 25, 154, 181, 249, 295
Sau96I GGNCC 1 cut(s) 302
SetI ASST 8 cut(s) 13, 88, 136, 199, 338, 387, 413, 442
SfaNI GCATC 1 cut(s) 13
SfcI CTRYAG 1 cut(s) 412
SinI GGWCC 1 cut(s) 302
Sse9I AATT 6 cut(s) 107, 140, 148, 269, 324, 330
SspMI CTAG 3 cut(s) 131, 159, 404
TasI AATT 6 cut(s) 107, 140, 148, 269, 324, 330
Tru1I TTAA 2 cut(s) 272, 456
Tru9I TTAA 2 cut(s) 272, 456
TscAI CASTG 1 cut(s) 28
TspDTI ATGAA 4 cut(s) 23, 117, 305, 477
TspRI CASTG 1 cut(s) 28
VpaK11BI GGWCC 1 cut(s) 302
XagI CCTNNNNNAGG 1 cut(s) 129
XapI RAATTY 2 cut(s) 107, 140
XbaI TCTAGA 1 cut(s) 403
XmiI GTMKAC 1 cut(s) 436
XspI CTAG 3 cut(s) 131, 159, 404
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.