Rw1G040520

Integrase core domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
OG0001471
Physical Location & Seq
Forward (+)
67772506 .. 67772847
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G040520.1

Sequence Viewer

Length: 342 bp
ATGTCAGACCTTGGAAAAATGAGGTATTTCCTAGGTGTGAAGGTTATTCAAAGCTCTGATGGGATATTCATTAACCAGAAGAAGTATGCTAATGAAGTGCTAGAGAAGTTTGGCATGGAACGCTGCAATCTTATGAAAAACCCGATTGTGCCAGGCTCCAAGCTTGTGAAGGATGAAGGAGGTGCATGTGTTGATGACACAACTTATAAACAAATGGTGGGCAGCCTCATGTATCTAACGGCCACCAGGCCCGACTTGATGTATGTGGTAAGCTTAATTAGTCGTTTTATGAAAAGGCCTACTTACTTGCATCATCAAGTTGTGAATAGAGTTTTGAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_2 gag_pre-integrs rve

Protein Analysis

113

Amino Acids

12.95

Weight (kDa)

9.58

Isoelectric Point (pI)

34.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_2 PF07727 1 - 50 5.4e-09 Reverse transcriptase (RNA-dependent DNA polymerase)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 207
AcoI YGGCCR 1 cut(s) 240
AgsI TTSAA 1 cut(s) 50
AjnI CCWGG 2 cut(s) 151, 245
AluBI AGCT 3 cut(s) 54, 163, 273
AluI AGCT 3 cut(s) 54, 163, 273
AoxI GGCC 3 cut(s) 240, 248, 296
ApeKI GCWGC 2 cut(s) 123, 222
AspA2I CCTAGG 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 249
AvrII CCTAGG 1 cut(s) 31
BbvI GCAGC 2 cut(s) 110, 234
BccI CCATC 1 cut(s) 53
BceAI ACGGC 1 cut(s) 255
BciT130I CCWGG 2 cut(s) 153, 247
BfaI CTAG 2 cut(s) 32, 101
BisI GCNGC 2 cut(s) 124, 223
BlnI CCTAGG 1 cut(s) 31
BlsI GCNGC 2 cut(s) 125, 224
Bme1390I CCNGG 2 cut(s) 153, 247
BmgT120I GGNCC 1 cut(s) 249
BmiI GGNNCC 1 cut(s) 157
BmrFI CCNGG 2 cut(s) 153, 247
BmsI GCATC 1 cut(s) 319
BsaJI CCNNGG 2 cut(s) 10, 31
BseBI CCWGG 2 cut(s) 153, 247
BseDI CCNNGG 2 cut(s) 10, 31
BseGI GGATG 1 cut(s) 178
BseXI GCAGC 2 cut(s) 110, 234
BshFI GGCC 3 cut(s) 242, 250, 298
BsnI GGCC 3 cut(s) 242, 250, 298
BspANI GGCC 3 cut(s) 242, 250, 298
BspLI GGNNCC 1 cut(s) 157
BssECI CCNNGG 2 cut(s) 10, 31
BssT1I CCWWGG 2 cut(s) 10, 31
Bst2UI CCWGG 2 cut(s) 153, 247
BstF5I GGATG 1 cut(s) 178
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstNI CCWGG 2 cut(s) 153, 247
BstNSI RCATGY 1 cut(s) 189
BstSCI CCNGG 2 cut(s) 151, 245
BstV1I GCAGC 2 cut(s) 110, 234
BsuRI GGCC 3 cut(s) 242, 250, 298
BtsCI GGATG 1 cut(s) 178
Cfr13I GGNCC 1 cut(s) 249
CviAII CATG 3 cut(s) 115, 186, 229
CviJI RGCY 8 cut(s) 54, 156, 163, 225, 242, 250, 273, 298
CviKI_1 RGCY 8 cut(s) 54, 156, 163, 225, 242, 250, 273, 298
EaeI YGGCCR 1 cut(s) 240
Eco130I CCWWGG 2 cut(s) 10, 31
Eco147I AGGCCT 1 cut(s) 298
EcoRII CCWGG 2 cut(s) 151, 245
EcoT14I CCWWGG 2 cut(s) 10, 31
ErhI CCWWGG 2 cut(s) 10, 31
FaeI CATG 3 cut(s) 118, 189, 232
FaiI YATR 8 cut(s) 87, 116, 134, 187, 207, 230, 264, 290
FalI AAGNNNNNCTT 2 cut(s) 286, 318
FatI CATG 3 cut(s) 114, 185, 228
Fnu4HI GCNGC 2 cut(s) 124, 223
FokI GGATG 1 cut(s) 185
Fsp4HI GCNGC 2 cut(s) 124, 223
FspBI CTAG 2 cut(s) 32, 101
GluI GCNGC 2 cut(s) 124, 223
HaeIII GGCC 3 cut(s) 242, 250, 298
Hin1II CATG 3 cut(s) 118, 189, 232
HindIII AAGCTT 2 cut(s) 161, 271
Hpy188I TCNGA 2 cut(s) 7, 58
HpyAV CCTTC 3 cut(s) 34, 163, 170
HpyCH4V TGCA 3 cut(s) 126, 185, 310
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
Hsp92II CATG 3 cut(s) 118, 189, 232
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 5 cut(s) 89, 138, 165, 232, 259
Lsp1109I GCAGC 2 cut(s) 110, 234
LweI GCATC 1 cut(s) 319
MaeI CTAG 2 cut(s) 32, 101
MboII GAAGA 1 cut(s) 91
MluCI AATT 1 cut(s) 276
MnlI CCTC 3 cut(s) 15, 173, 236
MseI TTAA 2 cut(s) 72, 275
MspR9I CCNGG 2 cut(s) 153, 247
MvaI CCWGG 2 cut(s) 153, 247
MwoI GCNNNNNNNGC 1 cut(s) 120
NlaIII CATG 3 cut(s) 118, 189, 232
NlaIV GGNNCC 1 cut(s) 157
NspI RCATGY 1 cut(s) 189
PceI AGGCCT 1 cut(s) 298
PkrI GCNGC 2 cut(s) 125, 224
PsiI TTATAA 1 cut(s) 207
Psp6I CCWGG 2 cut(s) 151, 245
PspGI CCWGG 2 cut(s) 151, 245
PspN4I GGNNCC 1 cut(s) 157
PspPI GGNCC 1 cut(s) 249
SaqAI TTAA 2 cut(s) 72, 275
SatI GCNGC 2 cut(s) 124, 223
Sau96I GGNCC 1 cut(s) 249
ScrFI CCNGG 2 cut(s) 153, 247
SetI ASST 8 cut(s) 12, 26, 37, 45, 56, 165, 184, 275
SfaNI GCATC 1 cut(s) 319
Sse9I AATT 1 cut(s) 276
SseBI AGGCCT 1 cut(s) 298
SspMI CTAG 2 cut(s) 32, 101
StuI AGGCCT 1 cut(s) 298
StyD4I CCNGG 2 cut(s) 151, 245
StyI CCWWGG 2 cut(s) 10, 31
TasI AATT 1 cut(s) 276
Tru1I TTAA 2 cut(s) 72, 275
Tru9I TTAA 2 cut(s) 72, 275
TseI GCWGC 2 cut(s) 123, 222
TspDTI ATGAA 5 cut(s) 58, 108, 149, 189, 305
XceI RCATGY 1 cut(s) 189
XmaJI CCTAGG 1 cut(s) 31
XspI CTAG 2 cut(s) 32, 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.