MD02G1073200.v1.1

O-methyltransferase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
5902646 .. 5902927
282 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1073200.v1.1.491

Sequence Viewer

Length: 231 bp
ATGGTAATGTACGATAACACACTCTGGGGAGGAACAGTTGCTTGGCTGGAAGAGGATGTTCCGGAGGCCAAAAGGGAGTGGCGGCAGTGTGCAATTGAGTTAAACGAATTGGTTTCCGCTGACACTCGCGTCGAAATTTTCAAGGTTACGATGGGTGACGGGATCACAATATGGCGTTTGCTGATCAAGTTAAATAAAATGCTTGACGAACAAGTATTATCCATAACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

77

Amino Acids

8.83

Weight (kDa)

4.53

Isoelectric Point (pI)

40.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_3 PF01596 2 - 59 2.6e-10 O-methyltransferase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 128
AccII CGCG 1 cut(s) 129
AccIII TCCGGA 1 cut(s) 61
AciI CCGC 2 cut(s) 82, 117
AclWI GGATC 1 cut(s) 170
AcsI RAATTY 1 cut(s) 135
AfaI GTAC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 142
AjuI GAANNNNNNNTTGG 2 cut(s) 25, 57
AlwI GGATC 1 cut(s) 170
Aor13HI TCCGGA 1 cut(s) 61
AoxI GGCC 1 cut(s) 66
ApoI RAATTY 1 cut(s) 135
AsuHPI GGTGA 1 cut(s) 167
BccI CCATC 1 cut(s) 145
BclI TGATCA 1 cut(s) 183
BisI GCNGC 1 cut(s) 83
BlsI GCNGC 1 cut(s) 84
BsaWI WCCGGW 1 cut(s) 61
BsaXI ACNNNNNCTCC 2 cut(s) 21, 51
BseAI TCCGGA 1 cut(s) 61
BseGI GGATG 1 cut(s) 61
Bsh1236I CGCG 1 cut(s) 129
BshFI GGCC 1 cut(s) 68
BsiSI CCGG 1 cut(s) 62
BsnI GGCC 1 cut(s) 68
Bsp13I TCCGGA 1 cut(s) 61
Bsp143I GATC 2 cut(s) 162, 183
BspACI CCGC 2 cut(s) 82, 117
BspANI GGCC 1 cut(s) 68
BspEI TCCGGA 1 cut(s) 61
BspFNI CGCG 1 cut(s) 129
BspPI GGATC 1 cut(s) 170
BssMI GATC 2 cut(s) 162, 183
Bst4CI ACNGT 1 cut(s) 37
Bst6I CTCTTC 1 cut(s) 45
BstF5I GGATG 1 cut(s) 61
BstFNI CGCG 1 cut(s) 129
BstKTI GATC 2 cut(s) 165, 186
BstMBI GATC 2 cut(s) 162, 183
BstUI CGCG 1 cut(s) 129
BsuRI GGCC 1 cut(s) 68
BtsCI GGATG 1 cut(s) 61
BtsI GCAGTG 1 cut(s) 92
BtsIMutI CAGTG 1 cut(s) 92
CseI GACGC 1 cut(s) 118
Csp6I GTAC 1 cut(s) 10
CviJI RGCY 2 cut(s) 46, 68
CviKI_1 RGCY 2 cut(s) 46, 68
CviQI GTAC 1 cut(s) 10
DpnI GATC 2 cut(s) 164, 185
DpnII GATC 2 cut(s) 162, 183
DrdI GACNNNNNNGTC 1 cut(s) 128
DseDI GACNNNNNNGTC 1 cut(s) 128
Eam1104I CTCTTC 1 cut(s) 45
EarI CTCTTC 1 cut(s) 45
FaiI YATR 2 cut(s) 172, 224
FbaI TGATCA 1 cut(s) 183
Fnu4HI GCNGC 1 cut(s) 83
FokI GGATG 1 cut(s) 68
Fsp4HI GCNGC 1 cut(s) 83
GluI GCNGC 1 cut(s) 83
HaeIII GGCC 1 cut(s) 68
HapII CCGG 1 cut(s) 62
HgaI GACGC 1 cut(s) 118
HpaII CCGG 1 cut(s) 62
HphI GGTGA 1 cut(s) 167
Hpy188III TCNNGA 1 cut(s) 62
Hpy99I CGWCG 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 92
Kpn2I TCCGGA 1 cut(s) 61
Ksp22I TGATCA 1 cut(s) 183
Kzo9I GATC 2 cut(s) 162, 183
LpnPI CCDG 3 cut(s) 10, 32, 75
MaeIII GTNAC 2 cut(s) 145, 155
MalI GATC 2 cut(s) 164, 185
MboI GATC 2 cut(s) 162, 183
MboII GAAGA 1 cut(s) 62
MfeI CAATTG 1 cut(s) 93
MluCI AATT 3 cut(s) 93, 107, 135
MnlI CCTC 3 cut(s) 23, 46, 58
MroI TCCGGA 1 cut(s) 61
MseI TTAA 2 cut(s) 101, 191
MspA1I CMGCKG 1 cut(s) 119
MspI CCGG 1 cut(s) 62
MunI CAATTG 1 cut(s) 93
MvnI CGCG 1 cut(s) 129
NdeII GATC 2 cut(s) 162, 183
NmuCI GTSAC 1 cut(s) 155
PkrI GCNGC 1 cut(s) 84
RsaI GTAC 1 cut(s) 11
RsaNI GTAC 1 cut(s) 10
SaqAI TTAA 2 cut(s) 101, 191
SatI GCNGC 1 cut(s) 83
Sau3AI GATC 2 cut(s) 162, 183
SetI ASST 1 cut(s) 147
Sse9I AATT 3 cut(s) 93, 107, 135
SsiI CCGC 2 cut(s) 82, 117
TaaI ACNGT 1 cut(s) 37
TaqI TCGA 1 cut(s) 132
TasI AATT 3 cut(s) 93, 107, 135
TauI GCSGC 1 cut(s) 85
Tru1I TTAA 2 cut(s) 101, 191
Tru9I TTAA 2 cut(s) 101, 191
TscAI CASTG 1 cut(s) 92
TseFI GTSAC 1 cut(s) 155
Tsp45I GTSAC 1 cut(s) 155
TspRI CASTG 1 cut(s) 92
XapI RAATTY 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.