MD03G1237900.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0002047
Physical Location & Seq
Forward (+)
32296332 .. 32298712
2381 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1237900.v1.1.491

Sequence Viewer

Length: 135 bp
ATGCCAAAAACACAGAGATCGGAAAGTTCAAAGTTTGGCCGGAACTTTCGAGGCGTTTTACGGCCAAACCACGGAGAGTTAGATGTCGTGCGAGTTTCCGGCGAGTCCGACGGCTTTCGAGGCTTTTTCCGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

5.04

Weight (kDa)

11.27

Isoelectric Point (pI)

44.04

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 37, 62
AfiI CCNNNNNNNGG 1 cut(s) 71
AgsI TTSAA 1 cut(s) 30
AoxI GGCC 2 cut(s) 37, 62
BceAI ACGGC 2 cut(s) 77, 127
BsaJI CCNNGG 1 cut(s) 70
BsaWI WCCGGW 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 71
BseDI CCNNGG 1 cut(s) 70
BseLI CCNNNNNNNGG 1 cut(s) 71
BshFI GGCC 2 cut(s) 39, 64
BsiSI CCGG 3 cut(s) 40, 99, 130
BslI CCNNNNNNNGG 1 cut(s) 71
BsnI GGCC 2 cut(s) 39, 64
Bsp143I GATC 1 cut(s) 17
BspANI GGCC 2 cut(s) 39, 64
BssECI CCNNGG 1 cut(s) 70
BssMI GATC 1 cut(s) 17
BstDSI CCRYGG 1 cut(s) 70
BstKTI GATC 1 cut(s) 20
BstMBI GATC 1 cut(s) 17
BstMWI GCNNNNNNNGC 1 cut(s) 120
BsuRI GGCC 2 cut(s) 39, 64
BtgI CCRYGG 1 cut(s) 70
CviJI RGCY 4 cut(s) 39, 64, 114, 123
CviKI_1 RGCY 4 cut(s) 39, 64, 114, 123
DpnI GATC 1 cut(s) 19
DpnII GATC 1 cut(s) 17
EaeI YGGCCR 2 cut(s) 37, 62
HaeIII GGCC 2 cut(s) 39, 64
HapII CCGG 3 cut(s) 40, 99, 130
HinfI GANTC 1 cut(s) 104
HpaII CCGG 3 cut(s) 40, 99, 130
Hpy188I TCNGA 2 cut(s) 22, 109
Hpy99I CGWCG 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
Kzo9I GATC 1 cut(s) 17
LpnPI CCDG 2 cut(s) 53, 112
MalI GATC 1 cut(s) 19
MboI GATC 1 cut(s) 17
MlyI GAGTC 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 132
MnlI CCTC 2 cut(s) 44, 113
MspI CCGG 3 cut(s) 40, 99, 130
MwoI GCNNNNNNNGC 1 cut(s) 120
NdeII GATC 1 cut(s) 17
PleI GAGTC 1 cut(s) 112
PpsI GAGTC 1 cut(s) 112
Sau3AI GATC 1 cut(s) 17
SchI GAGTC 1 cut(s) 113
SgeI CNNG 8 cut(s) 52, 62, 83, 100, 104, 111, 115, 131
TaqI TCGA 2 cut(s) 49, 118
TspGWI ACGGA 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.