pycom04g08140

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0002047
Physical Location & Seq
Forward (+)
9390455 .. 9390877
423 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g08140.2

Sequence Viewer

Length: 300 bp
ATGATTAAGTTTCACTGTGCACACACGGATTGCACAGGAAACCTTACCTTTTCTTTTTTTTTCTTTTCCGTGATTTCCTCTCATCTGTCCCTCACTCTCTCTTTTCCCCCCACTCAAGCTCTCATTCTCTTTCTCTCTCAAAAACCCACGGCCAAAACAACAAGTTCATCAAAACTTCACAGATCGACGAAACAAAAATCACCATCTTCTTCGTTTCGACGATACGAGTCCAACCATACCAATTTCAGGACTTTTCAAGCTTATAGGAAGCTTCTTGAGGTCCTAAGGAGGCTGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

100

Amino Acids

11.47

Weight (kDa)

10.5

Isoelectric Point (pI)

47.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 150
AfiI CCNNNNNNNGG 1 cut(s) 246
AgsI TTSAA 1 cut(s) 257
AluBI AGCT 3 cut(s) 119, 260, 271
AluI AGCT 3 cut(s) 119, 260, 271
Alw21I GWGCWC 1 cut(s) 22
Alw44I GTGCAC 1 cut(s) 18
AoxI GGCC 1 cut(s) 150
ApaLI GTGCAC 1 cut(s) 18
AspS9I GGNCC 1 cut(s) 280
AsuHPI GGTGA 1 cut(s) 192
AvaII GGWCC 1 cut(s) 280
AxyI CCTNAGG 1 cut(s) 284
BaeGI GKGCMC 1 cut(s) 22
Bbv12I GWGCWC 1 cut(s) 22
BccI CCATC 1 cut(s) 211
BceAI ACGGC 1 cut(s) 165
Bme18I GGWCC 1 cut(s) 280
BmgT120I GGNCC 1 cut(s) 280
BpuEI CTTGAG 2 cut(s) 99, 296
BsaJI CCNNGG 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 246
Bse21I CCTNAGG 1 cut(s) 284
BseDI CCNNGG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 246
BseSI GKGCMC 1 cut(s) 22
BshFI GGCC 1 cut(s) 152
BsiHKAI GWGCWC 1 cut(s) 22
BslFI GGGAC 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 246
BsmFI GGGAC 1 cut(s) 73
BsnI GGCC 1 cut(s) 152
Bsp1286I GDGCHC 1 cut(s) 22
Bsp143I GATC 1 cut(s) 182
BspANI GGCC 1 cut(s) 152
BssECI CCNNGG 1 cut(s) 147
BssMI GATC 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 284
BstDSI CCRYGG 1 cut(s) 147
BstKTI GATC 1 cut(s) 185
BstMBI GATC 1 cut(s) 182
BstSLI GKGCMC 1 cut(s) 22
Bsu36I CCTNAGG 1 cut(s) 284
BsuRI GGCC 1 cut(s) 152
BtgI CCRYGG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 280
CviJI RGCY 5 cut(s) 119, 152, 260, 271, 292
CviKI_1 RGCY 5 cut(s) 119, 152, 260, 271, 292
DdeI CTNAG 1 cut(s) 284
DpnI GATC 1 cut(s) 184
DpnII GATC 1 cut(s) 182
EaeI YGGCCR 1 cut(s) 150
Eco47I GGWCC 1 cut(s) 280
Eco81I CCTNAGG 1 cut(s) 284
EcoO109I RGGNCCY 1 cut(s) 280
FaiI YATR 2 cut(s) 237, 264
FaqI GGGAC 1 cut(s) 73
HaeIII GGCC 1 cut(s) 152
HindIII AAGCTT 2 cut(s) 258, 269
HinfI GANTC 1 cut(s) 227
HphI GGTGA 1 cut(s) 192
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 2 cut(s) 247, 275
Hpy8I GTNNAC 1 cut(s) 20
Hpy99I CGWCG 2 cut(s) 190, 222
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 2 cut(s) 20, 33
HpyF3I CTNAG 1 cut(s) 284
Kzo9I GATC 1 cut(s) 182
LpnPI CCDG 3 cut(s) 21, 232, 278
MalI GATC 1 cut(s) 184
MboI GATC 1 cut(s) 182
MboII GAAGA 2 cut(s) 198, 201
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 1 cut(s) 241
MlyI GAGTC 1 cut(s) 236
MmeI TCCRAC 1 cut(s) 255
MnlI CCTC 4 cut(s) 88, 101, 271, 282
MseI TTAA 1 cut(s) 6
NdeII GATC 1 cut(s) 182
PleI GAGTC 1 cut(s) 235
PpsI GAGTC 1 cut(s) 235
PpuMI RGGWCCY 1 cut(s) 280
Psp5II RGGWCCY 1 cut(s) 280
PspPI GGNCC 1 cut(s) 280
PspPPI RGGWCCY 1 cut(s) 280
SaqAI TTAA 1 cut(s) 6
Sau3AI GATC 1 cut(s) 182
Sau96I GGNCC 1 cut(s) 280
SchI GAGTC 1 cut(s) 236
SduI GDGCHC 1 cut(s) 22
SetI ASST 6 cut(s) 45, 50, 121, 262, 273, 282
SinI GGWCC 1 cut(s) 280
SmlI CTYRAG 2 cut(s) 114, 275
SmoI CTYRAG 2 cut(s) 114, 275
Sse9I AATT 1 cut(s) 241
TaaI ACNGT 1 cut(s) 17
TaqI TCGA 2 cut(s) 185, 217
TasI AATT 1 cut(s) 241
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TscAI CASTG 1 cut(s) 20
TspDTI ATGAA 1 cut(s) 156
TspGWI ACGGA 2 cut(s) 41, 58
TspRI CASTG 1 cut(s) 20
VneI GTGCAC 1 cut(s) 18
VpaK11BI GGWCC 1 cut(s) 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.