MD07G1104200.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
11806796 .. 11808317
1522 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1104200.v1.1.491

Sequence Viewer

Length: 123 bp
ATGCATTTAATTGGTTCTAGTTTAGCGGTGGTTGGCTCACGAGGTCCTTTCCGGCTTTCTGACAGATTTGGGACATGTAGGACTCACCTGAGGGTGATGTATTCTCATTTTAGTCCGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

41

Amino Acids

4.48

Weight (kDa)

11.42

Isoelectric Point (pI)

49.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 26
AflIII ACRYGT 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 44
AsuHPI GGTGA 2 cut(s) 77, 106
AvaII GGWCC 1 cut(s) 44
AxyI CCTNAGG 1 cut(s) 89
BauI CACGAG 1 cut(s) 39
BfaI CTAG 1 cut(s) 18
Bme18I GGWCC 1 cut(s) 44
BmgT120I GGNCC 1 cut(s) 44
Bse21I CCTNAGG 1 cut(s) 89
BseMII CTCAG 1 cut(s) 80
BsiSI CCGG 1 cut(s) 52
BslFI GGGAC 1 cut(s) 85
BsmFI GGGAC 1 cut(s) 85
BspACI CCGC 1 cut(s) 26
BspCNI CTCAG 1 cut(s) 81
BssSI CACGAG 1 cut(s) 39
Bst2BI CACGAG 1 cut(s) 39
BstDEI CTNAG 1 cut(s) 89
BstNSI RCATGY 1 cut(s) 78
Bsu36I CCTNAGG 1 cut(s) 89
Cfr13I GGNCC 1 cut(s) 44
CviAII CATG 1 cut(s) 75
CviJI RGCY 2 cut(s) 36, 55
CviKI_1 RGCY 2 cut(s) 36, 55
DdeI CTNAG 1 cut(s) 89
Eco47I GGWCC 1 cut(s) 44
Eco81I CCTNAGG 1 cut(s) 89
EcoO109I RGGNCCY 1 cut(s) 44
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 1 cut(s) 78
FaiI YATR 1 cut(s) 76
FaqI GGGAC 1 cut(s) 85
FatI CATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 18
HapII CCGG 1 cut(s) 52
Hin1II CATG 1 cut(s) 78
HinfI GANTC 1 cut(s) 82
HpaII CCGG 1 cut(s) 52
HphI GGTGA 2 cut(s) 77, 106
Hpy188I TCNGA 2 cut(s) 61, 117
Hpy188III TCNNGA 1 cut(s) 39
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 89
Hsp92II CATG 1 cut(s) 78
LpnPI CCDG 2 cut(s) 65, 101
MaeI CTAG 1 cut(s) 18
MluCI AATT 1 cut(s) 9
MlyI GAGTC 1 cut(s) 76
MnlI CCTC 2 cut(s) 35, 84
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 8
MspI CCGG 1 cut(s) 52
NlaIII CATG 1 cut(s) 78
NsiI ATGCAT 1 cut(s) 6
NspI RCATGY 1 cut(s) 78
PciI ACATGT 1 cut(s) 74
PleI GAGTC 1 cut(s) 76
PpsI GAGTC 1 cut(s) 76
PpuMI RGGWCCY 1 cut(s) 44
PscI ACATGT 1 cut(s) 74
Psp5II RGGWCCY 1 cut(s) 44
PspPI GGNCC 1 cut(s) 44
PspPPI RGGWCCY 1 cut(s) 44
SaqAI TTAA 1 cut(s) 8
Sau96I GGNCC 1 cut(s) 44
SchI GAGTC 1 cut(s) 76
SetI ASST 2 cut(s) 46, 90
SgeI CNNG 6 cut(s) 30, 51, 53, 64, 87, 100
SinI GGWCC 1 cut(s) 44
Sse9I AATT 1 cut(s) 9
SsiI CCGC 1 cut(s) 26
SspMI CTAG 1 cut(s) 18
TasI AATT 1 cut(s) 9
Tru1I TTAA 1 cut(s) 8
Tru9I TTAA 1 cut(s) 8
VpaK11BI GGWCC 1 cut(s) 44
XceI RCATGY 1 cut(s) 78
XspI CTAG 1 cut(s) 18
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.