pycom03g11450

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0002047
Physical Location & Seq
Reverse (-)
11252654 .. 11256482
3829 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g11450.1

Sequence Viewer

Length: 186 bp
ATGATTTATCAGTATTACCACGCGAGTAACAACCACAAGTTGAACATTTGGCCGGAGCTGTCGGGGCTTTTTCCGGCGAAACCACGGCGAGTTAGGGGTCGAGACAGAAATTCCGGCAAAACACTATTTCCGGCGAAACCAGTCCGGCGACGCGAGGAAGAAGACGCGCGCGTGGGCAGCGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.14

Weight (kDa)

10.62

Isoelectric Point (pI)

75.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 6 cut(s) 23, 153, 167, 169, 171, 182
AcoI YGGCCR 1 cut(s) 50
AcsI RAATTY 1 cut(s) 109
AgsI TTSAA 1 cut(s) 43
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
Alw26I GTCTC 1 cut(s) 96
AoxI GGCC 1 cut(s) 50
ApeKI GCWGC 1 cut(s) 177
ApoI RAATTY 1 cut(s) 109
AspLEI GCGC 3 cut(s) 169, 171, 182
BbsI GAAGAC 1 cut(s) 168
BceAI ACGGC 1 cut(s) 101
BcoDI GTCTC 1 cut(s) 96
BisI GCNGC 1 cut(s) 178
BlsI GCNGC 1 cut(s) 179
BpiI GAAGAC 1 cut(s) 168
BsaJI CCNNGG 1 cut(s) 83
Bse1I ACTGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 83
BseNI ACTGG 1 cut(s) 140
BsePI GCGCGC 1 cut(s) 167
Bsh1236I CGCG 6 cut(s) 23, 153, 167, 169, 171, 182
BshFI GGCC 1 cut(s) 52
BsiSI CCGG 5 cut(s) 53, 74, 114, 131, 145
BsmAI GTCTC 1 cut(s) 96
BsnI GGCC 1 cut(s) 52
BspANI GGCC 1 cut(s) 52
BspFNI CGCG 6 cut(s) 23, 153, 167, 169, 171, 182
BsrI ACTGG 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 83
BssHII GCGCGC 1 cut(s) 167
BstC8I GCNNGC 1 cut(s) 169
BstDSI CCRYGG 1 cut(s) 83
BstFNI CGCG 6 cut(s) 23, 153, 167, 169, 171, 182
BstHHI GCGC 3 cut(s) 169, 171, 182
BstMAI GTCTC 1 cut(s) 96
BstMWI GCNNNNNNNGC 2 cut(s) 64, 177
BstUI CGCG 6 cut(s) 23, 153, 167, 169, 171, 182
BstV2I GAAGAC 1 cut(s) 168
BsuRI GGCC 1 cut(s) 52
BtgI CCRYGG 1 cut(s) 83
Cac8I GCNNGC 1 cut(s) 169
CfoI GCGC 3 cut(s) 169, 171, 182
CseI GACGC 2 cut(s) 159, 173
CviJI RGCY 3 cut(s) 52, 58, 67
CviKI_1 RGCY 3 cut(s) 52, 58, 67
EaeI YGGCCR 1 cut(s) 50
Fnu4HI GCNGC 1 cut(s) 178
Fsp4HI GCNGC 1 cut(s) 178
GlaI GCGC 3 cut(s) 168, 170, 181
GluI GCNGC 1 cut(s) 178
HaeIII GGCC 1 cut(s) 52
HapII CCGG 5 cut(s) 53, 74, 114, 131, 145
HgaI GACGC 2 cut(s) 159, 173
HhaI GCGC 3 cut(s) 169, 171, 182
Hin6I GCGC 3 cut(s) 167, 169, 180
HinP1I GCGC 3 cut(s) 167, 169, 180
HpaII CCGG 5 cut(s) 53, 74, 114, 131, 145
Hpy188III TCNNGA 1 cut(s) 101
Hpy99I CGWCG 1 cut(s) 153
HpyF10VI GCNNNNNNNGC 2 cut(s) 64, 177
HspAI GCGC 3 cut(s) 167, 169, 180
LmnI GCTCC 1 cut(s) 55
LpnPI CCDG 6 cut(s) 66, 87, 127, 144, 153, 158
MaeIII GTNAC 1 cut(s) 26
MauBI CGCGCGCG 1 cut(s) 167
MboII GAAGA 2 cut(s) 170, 173
MluCI AATT 1 cut(s) 109
MnlI CCTC 1 cut(s) 148
MspI CCGG 5 cut(s) 53, 74, 114, 131, 145
MvnI CGCG 6 cut(s) 23, 153, 167, 169, 171, 182
MwoI GCNNNNNNNGC 2 cut(s) 64, 177
PauI GCGCGC 1 cut(s) 167
PkrI GCNGC 1 cut(s) 179
PteI GCGCGC 1 cut(s) 167
SatI GCNGC 1 cut(s) 178
SetI ASST 1 cut(s) 60
Sse9I AATT 1 cut(s) 109
TaqI TCGA 1 cut(s) 100
TasI AATT 1 cut(s) 109
TseI GCWGC 1 cut(s) 177
XapI RAATTY 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.