pycom03g23350

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr3
OG0002047
Physical Location & Seq
Forward (+)
23197369 .. 23197653
285 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom03g23350.2

Sequence Viewer

Length: 243 bp
ATGATTAAGTTTCACTGTGCACACACGGATTTTCCTCTCATTTGTCCCTCACTCTCTCTTTTTTCCCTCAGCTCCCTTAAACTCACTCAACTCTCATCTCTCCCGTCAAGCTCTCTCTCTCTCCCTCACTCTCAAACACACGGCAACAACACCAATTCTTCAAAACTTCACGGATCGATCAAAATAAAATCACCATCTTCTTCGTTTCGACGATACGAGTCCAACCATACCAATTTCAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.87

Weight (kDa)

10.04

Isoelectric Point (pI)

36.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 181
AfiI CCNNNNNNNGG 1 cut(s) 237
AgsI TTSAA 1 cut(s) 162
AluBI AGCT 2 cut(s) 72, 111
AluI AGCT 2 cut(s) 72, 111
Alw21I GWGCWC 1 cut(s) 22
Alw44I GTGCAC 1 cut(s) 18
AlwI GGATC 1 cut(s) 181
ApaLI GTGCAC 1 cut(s) 18
AsuHPI GGTGA 1 cut(s) 183
BaeGI GKGCMC 1 cut(s) 22
Bbv12I GWGCWC 1 cut(s) 22
BbvCI CCTCAGC 1 cut(s) 68
BccI CCATC 1 cut(s) 202
BceAI ACGGC 1 cut(s) 157
Bpu10I CCTNAGC 1 cut(s) 68
Bsa29I ATCGAT 1 cut(s) 176
Bsc4I CCNNNNNNNGG 1 cut(s) 237
BseCI ATCGAT 1 cut(s) 176
BseLI CCNNNNNNNGG 1 cut(s) 237
BseMII CTCAG 1 cut(s) 82
BseSI GKGCMC 1 cut(s) 22
BshVI ATCGAT 1 cut(s) 176
BsiHKAI GWGCWC 1 cut(s) 22
BslFI GGGAC 1 cut(s) 30
BslI CCNNNNNNNGG 1 cut(s) 237
BsmFI GGGAC 1 cut(s) 30
Bsp1286I GDGCHC 1 cut(s) 22
Bsp143I GATC 2 cut(s) 173, 177
BspCNI CTCAG 1 cut(s) 81
BspDI ATCGAT 1 cut(s) 176
BspPI GGATC 1 cut(s) 181
BssMI GATC 2 cut(s) 173, 177
Bst4CI ACNGT 1 cut(s) 17
BstDEI CTNAG 1 cut(s) 68
BstKTI GATC 2 cut(s) 176, 180
BstMBI GATC 2 cut(s) 173, 177
BstSLI GKGCMC 1 cut(s) 22
Bsu15I ATCGAT 1 cut(s) 176
BsuTUI ATCGAT 1 cut(s) 176
BtsIMutI CAGTG 1 cut(s) 13
ClaI ATCGAT 1 cut(s) 176
CviJI RGCY 2 cut(s) 72, 111
CviKI_1 RGCY 2 cut(s) 72, 111
DdeI CTNAG 1 cut(s) 68
DpnI GATC 2 cut(s) 175, 179
DpnII GATC 2 cut(s) 173, 177
FaiI YATR 1 cut(s) 228
FaqI GGGAC 1 cut(s) 30
HinfI GANTC 1 cut(s) 218
HphI GGTGA 1 cut(s) 183
Hpy166II GTNNAC 1 cut(s) 20
Hpy8I GTNNAC 1 cut(s) 20
Hpy99I CGWCG 1 cut(s) 213
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4V TGCA 1 cut(s) 20
HpyF3I CTNAG 1 cut(s) 68
Kzo9I GATC 2 cut(s) 173, 177
LmnI GCTCC 1 cut(s) 77
LpnPI CCDG 1 cut(s) 223
MalI GATC 2 cut(s) 175, 179
MboI GATC 2 cut(s) 173, 177
MboII GAAGA 3 cut(s) 150, 189, 192
MhlI GDGCHC 1 cut(s) 22
MluCI AATT 2 cut(s) 154, 232
MlyI GAGTC 1 cut(s) 227
MnlI CCTC 4 cut(s) 45, 58, 77, 135
MseI TTAA 2 cut(s) 6, 78
NdeII GATC 2 cut(s) 173, 177
PleI GAGTC 1 cut(s) 226
PpsI GAGTC 1 cut(s) 226
SaqAI TTAA 2 cut(s) 6, 78
Sau3AI GATC 2 cut(s) 173, 177
SchI GAGTC 1 cut(s) 227
SduI GDGCHC 1 cut(s) 22
SetI ASST 3 cut(s) 74, 113, 242
SgeI CNNG 6 cut(s) 37, 115, 120, 152, 182, 229
Sse9I AATT 2 cut(s) 154, 232
TaaI ACNGT 1 cut(s) 17
TaqI TCGA 2 cut(s) 176, 208
TasI AATT 2 cut(s) 154, 232
Tru1I TTAA 2 cut(s) 6, 78
Tru9I TTAA 2 cut(s) 6, 78
TscAI CASTG 1 cut(s) 20
TspGWI ACGGA 2 cut(s) 41, 186
TspRI CASTG 1 cut(s) 20
VneI GTGCAC 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.