MD11G1294700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
41340413 .. 41342380
1968 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1294700.v1.1.491

Sequence Viewer

Length: 216 bp
ATGACGAGATTGCCCTTGACGTTACTAAGGTACTTGTGTGTGAGACGTATCCCGAGGACGACCGCATCCAGGGACGCCACGGGGGTTACGACCCGTCGACTTATCAGTTCTAGTTTAGCGGTGGTTGGCTCACGAGGTCCTTTCCGGCTTTCTGACAGATTTTGGACATGTAGGACTCACCTGAGGGTGATGTATTCTTATTTTAGTCCTACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

72

Amino Acids

8.22

Weight (kDa)

11.8

Isoelectric Point (pI)

45.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 97
AciI CCGC 2 cut(s) 63, 119
AcyI GRCGYC 1 cut(s) 75
AfaI GTAC 1 cut(s) 32
AfiI CCNNNNNNNGG 1 cut(s) 69
AflIII ACRYGT 1 cut(s) 167
AjnI CCWGG 1 cut(s) 68
Alw26I GTCTC 1 cut(s) 37
Ama87I CYCGRG 1 cut(s) 52
AspS9I GGNCC 1 cut(s) 137
AsuHPI GGTGA 2 cut(s) 170, 199
AvaI CYCGRG 1 cut(s) 52
AvaII GGWCC 1 cut(s) 137
AxyI CCTNAGG 1 cut(s) 182
BaeI ACNNNNGTAYC 2 cut(s) 22, 55
BauI CACGAG 1 cut(s) 132
BciT130I CCWGG 1 cut(s) 70
BciVI GTATCC 1 cut(s) 59
BcoDI GTCTC 1 cut(s) 37
BfaI CTAG 1 cut(s) 111
BfuI GTATCC 1 cut(s) 59
Bme1390I CCNGG 1 cut(s) 70
Bme18I GGWCC 1 cut(s) 137
BmeT110I CYCGRG 1 cut(s) 52
BmgT120I GGNCC 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 70
BmsI GCATC 1 cut(s) 74
BsaHI GRCGYC 1 cut(s) 75
BsaJI CCNNGG 3 cut(s) 53, 69, 78
Bsc4I CCNNNNNNNGG 1 cut(s) 69
Bse21I CCTNAGG 1 cut(s) 182
BseBI CCWGG 1 cut(s) 70
BseDI CCNNGG 3 cut(s) 53, 69, 78
BseGI GGATG 1 cut(s) 65
BseLI CCNNNNNNNGG 1 cut(s) 69
BseMII CTCAG 1 cut(s) 173
Bsh1285I CGRYCG 1 cut(s) 63
BsiEI CGRYCG 1 cut(s) 63
BsiHKCI CYCGRG 1 cut(s) 52
BsiSI CCGG 1 cut(s) 145
BslFI GGGAC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 69
BsmAI GTCTC 1 cut(s) 37
BsmBI CGTCTC 1 cut(s) 37
BsmFI GGGAC 1 cut(s) 86
BsoBI CYCGRG 1 cut(s) 52
BspACI CCGC 2 cut(s) 63, 119
BspCNI CTCAG 1 cut(s) 174
BssECI CCNNGG 3 cut(s) 53, 69, 78
BssNI GRCGYC 1 cut(s) 75
BssSI CACGAG 1 cut(s) 132
Bst2BI CACGAG 1 cut(s) 132
Bst2UI CCWGG 1 cut(s) 70
BstACI GRCGYC 1 cut(s) 75
BstDEI CTNAG 2 cut(s) 26, 182
BstDSI CCRYGG 1 cut(s) 78
BstF5I GGATG 1 cut(s) 65
BstMAI GTCTC 1 cut(s) 37
BstMCI CGRYCG 1 cut(s) 63
BstNI CCWGG 1 cut(s) 70
BstNSI RCATGY 1 cut(s) 171
BstSCI CCNGG 1 cut(s) 68
Bsu36I CCTNAGG 1 cut(s) 182
BsuI GTATCC 1 cut(s) 59
BtgI CCRYGG 1 cut(s) 78
BtsCI GGATG 1 cut(s) 65
Cfr13I GGNCC 1 cut(s) 137
CseI GACGC 1 cut(s) 83
Csp6I GTAC 1 cut(s) 31
CviAII CATG 1 cut(s) 168
CviJI RGCY 2 cut(s) 129, 148
CviKI_1 RGCY 2 cut(s) 129, 148
CviQI GTAC 1 cut(s) 31
DdeI CTNAG 2 cut(s) 26, 182
Eco47I GGWCC 1 cut(s) 137
Eco81I CCTNAGG 1 cut(s) 182
Eco88I CYCGRG 1 cut(s) 52
EcoO109I RGGNCCY 1 cut(s) 137
EcoRII CCWGG 1 cut(s) 68
Esp3I CGTCTC 1 cut(s) 37
FaeI CATG 1 cut(s) 171
FaiI YATR 1 cut(s) 169
FaqI GGGAC 1 cut(s) 86
FatI CATG 1 cut(s) 167
FblI GTMKAC 1 cut(s) 97
FokI GGATG 1 cut(s) 52
FspBI CTAG 1 cut(s) 111
HapII CCGG 1 cut(s) 145
HgaI GACGC 1 cut(s) 83
Hin1I GRCGYC 1 cut(s) 75
Hin1II CATG 1 cut(s) 171
HincII GTYRAC 1 cut(s) 98
HindII GTYRAC 1 cut(s) 98
HinfI GANTC 1 cut(s) 175
HpaII CCGG 1 cut(s) 145
HphI GGTGA 2 cut(s) 170, 199
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 154
Hpy188III TCNNGA 2 cut(s) 52, 132
Hpy8I GTNNAC 1 cut(s) 98
Hpy99I CGWCG 1 cut(s) 99
HpyCH4IV ACGT 2 cut(s) 20, 46
HpyF3I CTNAG 2 cut(s) 26, 182
HpySE526I ACGT 2 cut(s) 20, 46
Hsp92I GRCGYC 1 cut(s) 75
Hsp92II CATG 1 cut(s) 171
LpnPI CCDG 4 cut(s) 55, 82, 158, 194
LweI GCATC 1 cut(s) 74
MaeI CTAG 1 cut(s) 111
MaeII ACGT 2 cut(s) 20, 46
MaeIII GTNAC 2 cut(s) 21, 85
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 3 cut(s) 48, 128, 177
MspI CCGG 1 cut(s) 145
MspR9I CCNGG 1 cut(s) 70
MvaI CCWGG 1 cut(s) 70
NlaIII CATG 1 cut(s) 171
NspI RCATGY 1 cut(s) 171
PciI ACATGT 1 cut(s) 167
PcsI WCGNNNNNNNCGW 1 cut(s) 86
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PpuMI RGGWCCY 1 cut(s) 137
PscI ACATGT 1 cut(s) 167
Psp5II RGGWCCY 1 cut(s) 137
Psp6I CCWGG 1 cut(s) 68
PspGI CCWGG 1 cut(s) 68
PspPI GGNCC 1 cut(s) 137
PspPPI RGGWCCY 1 cut(s) 137
RsaI GTAC 1 cut(s) 32
RsaNI GTAC 1 cut(s) 31
SalI GTCGAC 1 cut(s) 96
Sau96I GGNCC 1 cut(s) 137
SchI GAGTC 1 cut(s) 169
ScrFI CCNGG 1 cut(s) 70
SetI ASST 5 cut(s) 23, 32, 49, 139, 183
SfaNI GCATC 1 cut(s) 74
SinI GGWCC 1 cut(s) 137
SsiI CCGC 2 cut(s) 63, 119
SspMI CTAG 1 cut(s) 111
StyD4I CCNGG 1 cut(s) 68
TaiI ACGT 2 cut(s) 23, 49
TaqI TCGA 1 cut(s) 97
VpaK11BI GGWCC 1 cut(s) 137
XceI RCATGY 1 cut(s) 171
XmiI GTMKAC 1 cut(s) 97
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.