pycom15g19380

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
OG0002047
Physical Location & Seq
Forward (+)
13816537 .. 13817215
679 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g19380.3

Sequence Viewer

Length: 324 bp
ATGGTACCATTTTCAGCTTGTAGGAAGCTTGGTGAGGTCCTAAGGAAGCTTGGAGTGCTTCGTTTGAAGGATTTGGACGTCGGGATCACGAACTATTACGTGAAAAATGGACGTAAGAACAAGGAGAATGACAAGTTCAAAGTTTGGCCGGAGCTTTCGGGGCTTTTCCGGCGAATCCACGGCGAGTTAGGGGTCAAGAAATTCCGGCAAAACACCCACCGCCGGCGAAACCACTCCAAATTGAGTTCTGAAAATTGTCACGCGTTCGTGACGTCGTGTAGATCACCGTGGTATATTCATACACCCAAATTGAGCAACGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

108

Amino Acids

12.54

Weight (kDa)

10.41

Isoelectric Point (pI)

48.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 2 cut(s) 81, 275
Acc65I GGTACC 1 cut(s) 4
AccB1I GGYRCC 1 cut(s) 4
AccII CGCG 1 cut(s) 263
AciI CCGC 1 cut(s) 220
AclWI GGATC 1 cut(s) 92
AcoI YGGCCR 1 cut(s) 146
AcsI RAATTY 1 cut(s) 200
AcyI GRCGYC 2 cut(s) 78, 272
AfaI GTAC 1 cut(s) 6
AfiI CCNNNNNNNGG 1 cut(s) 222
AflIII ACRYGT 1 cut(s) 261
AgsI TTSAA 2 cut(s) 67, 139
AluBI AGCT 4 cut(s) 17, 28, 49, 154
AluI AGCT 4 cut(s) 17, 28, 49, 154
AlwI GGATC 1 cut(s) 92
AoxI GGCC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 200
Asp718I GGTACC 1 cut(s) 4
AspS9I GGNCC 1 cut(s) 37
AsuHPI GGTGA 2 cut(s) 44, 276
AvaII GGWCC 1 cut(s) 37
AxyI CCTNAGG 1 cut(s) 41
BanI GGYRCC 1 cut(s) 4
BceAI ACGGC 1 cut(s) 196
Bme18I GGWCC 1 cut(s) 37
BmgT120I GGNCC 1 cut(s) 37
BmiI GGNNCC 1 cut(s) 6
BsaAI YACGTR 1 cut(s) 100
BsaHI GRCGYC 2 cut(s) 78, 272
BsaJI CCNNGG 2 cut(s) 178, 287
Bsc4I CCNNNNNNNGG 1 cut(s) 222
Bse118I RCCGGY 1 cut(s) 222
Bse21I CCTNAGG 1 cut(s) 41
BseDI CCNNGG 2 cut(s) 178, 287
BseLI CCNNNNNNNGG 1 cut(s) 222
Bsh1236I CGCG 1 cut(s) 263
BshFI GGCC 1 cut(s) 148
BshNI GGYRCC 1 cut(s) 4
BsiSI CCGG 4 cut(s) 149, 169, 205, 223
BslI CCNNNNNNNGG 1 cut(s) 222
BsnI GGCC 1 cut(s) 148
Bsp143I GATC 2 cut(s) 84, 281
BspACI CCGC 1 cut(s) 220
BspANI GGCC 1 cut(s) 148
BspFNI CGCG 1 cut(s) 263
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 92
BspT107I GGYRCC 1 cut(s) 4
BsrFI RCCGGY 1 cut(s) 222
BssAI RCCGGY 1 cut(s) 222
BssECI CCNNGG 2 cut(s) 178, 287
BssMI GATC 2 cut(s) 84, 281
BssNI GRCGYC 2 cut(s) 78, 272
Bst4CI ACNGT 1 cut(s) 288
BstACI GRCGYC 2 cut(s) 78, 272
BstBAI YACGTR 1 cut(s) 100
BstC8I GCNNGC 1 cut(s) 224
BstDEI CTNAG 1 cut(s) 41
BstDSI CCRYGG 2 cut(s) 178, 287
BstFNI CGCG 1 cut(s) 263
BstKTI GATC 2 cut(s) 87, 284
BstMBI GATC 2 cut(s) 84, 281
BstMWI GCNNNNNNNGC 3 cut(s) 55, 160, 169
BstUI CGCG 1 cut(s) 263
Bsu36I CCTNAGG 1 cut(s) 41
BsuRI GGCC 1 cut(s) 148
BtgI CCRYGG 2 cut(s) 178, 287
Cac8I GCNNGC 1 cut(s) 224
Cfr10I RCCGGY 1 cut(s) 222
Cfr13I GGNCC 1 cut(s) 37
Csp6I GTAC 1 cut(s) 5
CviJI RGCY 6 cut(s) 17, 28, 49, 148, 154, 163
CviKI_1 RGCY 6 cut(s) 17, 28, 49, 148, 154, 163
CviQI GTAC 1 cut(s) 5
DdeI CTNAG 1 cut(s) 41
DpnI GATC 2 cut(s) 86, 283
DpnII GATC 2 cut(s) 84, 281
EaeI YGGCCR 1 cut(s) 146
Eco47I GGWCC 1 cut(s) 37
Eco81I CCTNAGG 1 cut(s) 41
EcoO109I RGGNCCY 1 cut(s) 37
FaiI YATR 3 cut(s) 294, 300, 322
HaeIII GGCC 1 cut(s) 148
HapII CCGG 4 cut(s) 149, 169, 205, 223
Hin1I GRCGYC 2 cut(s) 78, 272
HindIII AAGCTT 2 cut(s) 26, 47
HinfI GANTC 1 cut(s) 174
HpaII CCGG 4 cut(s) 149, 169, 205, 223
HphI GGTGA 2 cut(s) 44, 276
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 4 cut(s) 82, 88, 196, 268
Hpy99I CGWCG 2 cut(s) 83, 277
HpyAV CCTTC 1 cut(s) 61
HpyCH4III ACNGT 1 cut(s) 288
HpyCH4IV ACGT 5 cut(s) 78, 99, 112, 272, 318
HpyF10VI GCNNNNNNNGC 3 cut(s) 55, 160, 169
HpyF3I CTNAG 1 cut(s) 41
HpySE526I ACGT 5 cut(s) 78, 99, 112, 272, 318
Hsp92I GRCGYC 2 cut(s) 78, 272
KpnI GGTACC 1 cut(s) 8
KroI GCCGGC 1 cut(s) 222
KroNI GCCGGC 1 cut(s) 224
Kzo9I GATC 2 cut(s) 84, 281
LmnI GCTCC 1 cut(s) 151
LpnPI CCDG 4 cut(s) 162, 182, 218, 236
MaeII ACGT 5 cut(s) 78, 99, 112, 272, 318
MaeIII GTNAC 2 cut(s) 257, 268
MalI GATC 2 cut(s) 86, 283
MboI GATC 2 cut(s) 84, 281
MluCI AATT 4 cut(s) 200, 239, 253, 308
MluI ACGCGT 1 cut(s) 261
MnlI CCTC 1 cut(s) 28
MreI CGCCGGCG 1 cut(s) 222
MroNI GCCGGC 1 cut(s) 222
MspI CCGG 4 cut(s) 149, 169, 205, 223
MvnI CGCG 1 cut(s) 263
MwoI GCNNNNNNNGC 3 cut(s) 55, 160, 169
NaeI GCCGGC 1 cut(s) 224
NdeII GATC 2 cut(s) 84, 281
NgoMIV GCCGGC 1 cut(s) 222
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 2 cut(s) 257, 268
PdiI GCCGGC 1 cut(s) 224
PfeI GAWTC 1 cut(s) 174
Ppu21I YACGTR 1 cut(s) 100
PpuMI RGGWCCY 1 cut(s) 37
Psp5II RGGWCCY 1 cut(s) 37
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 37
PspPPI RGGWCCY 1 cut(s) 37
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
Sau3AI GATC 2 cut(s) 84, 281
Sau96I GGNCC 1 cut(s) 37
SgrAI CRCCGGYG 1 cut(s) 222
SinI GGWCC 1 cut(s) 37
Sse9I AATT 4 cut(s) 200, 239, 253, 308
SsiI CCGC 1 cut(s) 220
TaaI ACNGT 1 cut(s) 288
TaiI ACGT 5 cut(s) 81, 102, 115, 275, 321
TasI AATT 4 cut(s) 200, 239, 253, 308
TfiI GAWTC 1 cut(s) 174
TseFI GTSAC 2 cut(s) 257, 268
Tsp45I GTSAC 2 cut(s) 257, 268
TspDTI ATGAA 1 cut(s) 287
VpaK11BI GGWCC 1 cut(s) 37
XapI RAATTY 1 cut(s) 200
ZraI GACGTC 2 cut(s) 79, 273
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.