MD05G1150300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0002047
Physical Location & Seq
Reverse (-)
28120050 .. 28120931
882 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1150300.v1.1.491

Sequence Viewer

Length: 264 bp
ATGGGAGAAGTGGGAATTGCGGAGGGAGGGTGGGAGGGAGGGAGGGATGGGGTTGGTTTTGAAAGATTTGCTCCACCTAGGATTGTTCGTGTAAGATTTCGACAGCGTTCTCCCTCCTCTGAGGTCCTCCCCAACGAAGCCGTCAATCGCCTCCTCGCTCAAGGTGAAATTGAAGGTCAGCAGATCTCTCACATTGATGAGGGGCTACAATTCGTGCAACGAAAAAGCCAGAGATATGCTACTAATTTGGAAGAGAATAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.81

Weight (kDa)

5.83

Isoelectric Point (pI)

56.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 20
AgsI TTSAA 2 cut(s) 62, 173
AspA2I CCTAGG 1 cut(s) 77
AspS9I GGNCC 1 cut(s) 124
AsuHPI GGTGA 1 cut(s) 176
AvaII GGWCC 1 cut(s) 124
AvrII CCTAGG 1 cut(s) 77
BccI CCATC 1 cut(s) 41
BceAI ACGGC 1 cut(s) 125
BfaI CTAG 1 cut(s) 78
BglII AGATCT 1 cut(s) 183
BlnI CCTAGG 1 cut(s) 77
Bme18I GGWCC 1 cut(s) 124
BmgT120I GGNCC 1 cut(s) 124
BpuEI CTTGAG 1 cut(s) 144
BsaJI CCNNGG 1 cut(s) 77
BsaXI ACNNNNNCTCC 2 cut(s) 14, 44
BseDI CCNNGG 1 cut(s) 77
BseGI GGATG 1 cut(s) 52
BseMII CTCAG 1 cut(s) 111
BseRI GAGGAG 2 cut(s) 106, 143
Bsp143I GATC 1 cut(s) 183
BspACI CCGC 1 cut(s) 20
BspCNI CTCAG 1 cut(s) 112
BssECI CCNNGG 1 cut(s) 77
BssMI GATC 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 77
Bst6I CTCTTC 1 cut(s) 246
BstDEI CTNAG 1 cut(s) 120
BstF5I GGATG 1 cut(s) 52
BstKTI GATC 1 cut(s) 186
BstMBI GATC 1 cut(s) 183
BstX2I RGATCY 1 cut(s) 183
BstYI RGATCY 1 cut(s) 183
BtsCI GGATG 1 cut(s) 52
Cfr13I GGNCC 1 cut(s) 124
CviJI RGCY 3 cut(s) 140, 205, 228
CviKI_1 RGCY 3 cut(s) 140, 205, 228
DdeI CTNAG 1 cut(s) 120
DpnI GATC 1 cut(s) 185
DpnII GATC 1 cut(s) 183
Eam1104I CTCTTC 1 cut(s) 246
EarI CTCTTC 1 cut(s) 246
Eco130I CCWWGG 1 cut(s) 77
Eco47I GGWCC 1 cut(s) 124
EcoO109I RGGNCCY 1 cut(s) 124
EcoT14I CCWWGG 1 cut(s) 77
ErhI CCWWGG 1 cut(s) 77
FaiI YATR 1 cut(s) 237
FokI GGATG 1 cut(s) 59
FspBI CTAG 1 cut(s) 78
HphI GGTGA 1 cut(s) 176
Hpy188I TCNGA 1 cut(s) 121
HpyAV CCTTC 1 cut(s) 167
HpyCH4V TGCA 1 cut(s) 217
HpyF3I CTNAG 1 cut(s) 120
Kzo9I GATC 1 cut(s) 183
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 1 cut(s) 242
MaeI CTAG 1 cut(s) 78
MalI GATC 1 cut(s) 185
MboI GATC 1 cut(s) 183
MboII GAAGA 1 cut(s) 263
MflI RGATCY 1 cut(s) 183
MluCI AATT 4 cut(s) 15, 168, 209, 244
MslI CAYNNNNRTG 1 cut(s) 195
NdeII GATC 1 cut(s) 183
PpuMI RGGWCCY 1 cut(s) 124
Psp5II RGGWCCY 1 cut(s) 124
PspPI GGNCC 1 cut(s) 124
PspPPI RGGWCCY 1 cut(s) 124
PsuI RGATCY 1 cut(s) 183
RseI CAYNNNNRTG 1 cut(s) 195
Sau3AI GATC 1 cut(s) 183
Sau96I GGNCC 1 cut(s) 124
SetI ASST 4 cut(s) 79, 126, 166, 178
SgeI CNNG 6 cut(s) 90, 101, 167, 173, 226, 241
SinI GGWCC 1 cut(s) 124
SmiMI CAYNNNNRTG 1 cut(s) 195
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 4 cut(s) 15, 168, 209, 244
SsiI CCGC 1 cut(s) 20
SspMI CTAG 1 cut(s) 78
StyI CCWWGG 1 cut(s) 77
TaqI TCGA 1 cut(s) 100
TasI AATT 4 cut(s) 15, 168, 209, 244
VpaK11BI GGWCC 1 cut(s) 124
XmaJI CCTAGG 1 cut(s) 77
XspI CTAG 1 cut(s) 78
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.