MD04G1065100.v1.1

U-box domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
8741662 .. 8744334
2673 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1065100.v1.1.491

Sequence Viewer

Length: 180 bp
ATGGATTGCCCTAATTGTTGCGAAATTGAGAATGACGAATGGAGGTACTATGTATCTTGTAGCCCTGACCATGAGCTCGACCTATCTGAGGATGATATGGATTATGAGGACAGTCCTATAGAGTTCCTTGACATGGGGCTACAGGGAACTATGCTACGCCGTTTGCATCATGGTGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

7.0

Weight (kDa)

4.05

Isoelectric Point (pI)

73.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 47
AfiI CCNNNNNNNGG 2 cut(s) 88, 133
AluBI AGCT 1 cut(s) 76
AluI AGCT 1 cut(s) 76
Alw21I GWGCWC 1 cut(s) 78
BanII GRGCYC 1 cut(s) 78
Bbv12I GWGCWC 1 cut(s) 78
BceAI ACGGC 1 cut(s) 144
BfmI CTRYAG 2 cut(s) 117, 140
BmsI GCATC 1 cut(s) 175
Bsc4I CCNNNNNNNGG 2 cut(s) 88, 133
BseGI GGATG 1 cut(s) 97
BseLI CCNNNNNNNGG 2 cut(s) 88, 133
BseMII CTCAG 1 cut(s) 78
BsiHKAI GWGCWC 1 cut(s) 78
BslI CCNNNNNNNGG 2 cut(s) 88, 133
Bsp1286I GDGCHC 1 cut(s) 78
BspCNI CTCAG 1 cut(s) 79
Bst4CI ACNGT 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 87
BstENI CCTNNNNNAGG 1 cut(s) 86
BstF5I GGATG 1 cut(s) 97
BstSFI CTRYAG 2 cut(s) 117, 140
BtsCI GGATG 1 cut(s) 97
Csp6I GTAC 1 cut(s) 46
CviAII CATG 3 cut(s) 71, 133, 170
CviJI RGCY 3 cut(s) 63, 76, 139
CviKI_1 RGCY 3 cut(s) 63, 76, 139
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 1 cut(s) 87
Ecl136II GAGCTC 1 cut(s) 76
Eco24I GRGCYC 1 cut(s) 78
Eco53kI GAGCTC 1 cut(s) 76
EcoICRI GAGCTC 1 cut(s) 76
EcoNI CCTNNNNNAGG 1 cut(s) 86
EcoT38I GRGCYC 1 cut(s) 78
FaeI CATG 3 cut(s) 74, 136, 173
FaiI YATR 8 cut(s) 51, 72, 98, 105, 119, 134, 152, 171
FatI CATG 3 cut(s) 70, 132, 169
FokI GGATG 1 cut(s) 104
FriOI GRGCYC 1 cut(s) 78
Hin1II CATG 3 cut(s) 74, 136, 173
Hpy188I TCNGA 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 113
HpyCH4V TGCA 1 cut(s) 166
HpyF3I CTNAG 1 cut(s) 87
Hsp92II CATG 3 cut(s) 74, 136, 173
LpnPI CCDG 2 cut(s) 78, 128
LweI GCATC 1 cut(s) 175
MhlI GDGCHC 1 cut(s) 78
MluCI AATT 2 cut(s) 13, 24
MnlI CCTC 3 cut(s) 36, 82, 100
MslI CAYNNNNRTG 1 cut(s) 171
NlaIII CATG 3 cut(s) 74, 136, 173
Psp124BI GAGCTC 1 cut(s) 78
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
RseI CAYNNNNRTG 1 cut(s) 171
SacI GAGCTC 1 cut(s) 78
SduI GDGCHC 1 cut(s) 78
SetI ASST 3 cut(s) 47, 78, 84
SfaNI GCATC 1 cut(s) 175
SfcI CTRYAG 2 cut(s) 117, 140
SgeI CNNG 7 cut(s) 69, 77, 83, 89, 140, 145, 155
SmiMI CAYNNNNRTG 1 cut(s) 171
Sse9I AATT 2 cut(s) 13, 24
SstI GAGCTC 1 cut(s) 78
TaaI ACNGT 1 cut(s) 113
TaqI TCGA 1 cut(s) 78
TasI AATT 2 cut(s) 13, 24
XagI CCTNNNNNAGG 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.