Rh6DG351700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
55160623 .. 55161720
1098 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG351700.1

Sequence Viewer

Length: 195 bp
ATGGAGACAGGTTTTGGAGGATGCCCGAGTGCTACATCCGTGGGAATACTATTAAGTATCTGCGAGTTCCTGATGAGGTGGAGGACGAGGCCGAGCTTGATTCAGCTTATACTGTGGAACAACTTAGATGGGCAAGTTGCTACTTTTAAGGGCATTTGTGGCCCGATGCTTTTGTGGAATCTCGGGGTTTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.07

Weight (kDa)

7.73

Isoelectric Point (pI)

39.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 2 cut(s) 96, 106
AluI AGCT 2 cut(s) 96, 106
Ama87I CYCGRG 2 cut(s) 25, 182
AoxI GGCC 2 cut(s) 89, 160
AspS9I GGNCC 1 cut(s) 161
AvaI CYCGRG 2 cut(s) 25, 182
BccI CCATC 1 cut(s) 122
BfaI CTAG 1 cut(s) 193
BmeT110I CYCGRG 2 cut(s) 25, 182
BmgT120I GGNCC 1 cut(s) 161
BmsI GCATC 2 cut(s) 11, 156
BsaJI CCNNGG 1 cut(s) 39
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 2 cut(s) 26, 35
BshFI GGCC 2 cut(s) 91, 162
BsiHKCI CYCGRG 2 cut(s) 25, 182
BsnI GGCC 2 cut(s) 91, 162
BsoBI CYCGRG 2 cut(s) 25, 182
BspANI GGCC 2 cut(s) 91, 162
BssECI CCNNGG 1 cut(s) 39
Bst4CI ACNGT 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 124
BstDSI CCRYGG 1 cut(s) 39
BstF5I GGATG 2 cut(s) 26, 35
BstMWI GCNNNNNNNGC 1 cut(s) 159
BsuRI GGCC 2 cut(s) 91, 162
BtgI CCRYGG 1 cut(s) 39
BtsCI GGATG 2 cut(s) 26, 35
Cfr13I GGNCC 1 cut(s) 161
CviJI RGCY 4 cut(s) 91, 96, 106, 162
CviKI_1 RGCY 4 cut(s) 91, 96, 106, 162
DdeI CTNAG 1 cut(s) 124
Eco88I CYCGRG 2 cut(s) 25, 182
FaiI YATR 1 cut(s) 110
FokI GGATG 2 cut(s) 22, 33
FspBI CTAG 1 cut(s) 193
HaeIII GGCC 2 cut(s) 91, 162
HinfI GANTC 2 cut(s) 100, 178
Hpy188III TCNNGA 1 cut(s) 70
HpyCH4III ACNGT 1 cut(s) 114
HpyF10VI GCNNNNNNNGC 1 cut(s) 159
HpyF3I CTNAG 1 cut(s) 124
LpnPI CCDG 1 cut(s) 83
LweI GCATC 2 cut(s) 11, 156
MaeI CTAG 1 cut(s) 193
MnlI CCTC 4 cut(s) 11, 69, 75, 81
MseI TTAA 2 cut(s) 53, 147
MwoI GCNNNNNNNGC 1 cut(s) 159
NmeAIII GCCGAG 1 cut(s) 117
PfeI GAWTC 2 cut(s) 100, 178
PspPI GGNCC 1 cut(s) 161
SaqAI TTAA 2 cut(s) 53, 147
Sau96I GGNCC 1 cut(s) 161
SetI ASST 4 cut(s) 13, 80, 98, 108
SfaNI GCATC 2 cut(s) 11, 156
SspMI CTAG 1 cut(s) 193
TaaI ACNGT 1 cut(s) 114
TfiI GAWTC 2 cut(s) 100, 178
Tru1I TTAA 2 cut(s) 53, 147
Tru9I TTAA 2 cut(s) 53, 147
TspGWI ACGGA 1 cut(s) 28
XspI CTAG 1 cut(s) 193
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.