Rh4BG245100

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001780
Physical Location & Seq
Forward (+)
41218709 .. 41219471
763 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG245100.1

Sequence Viewer

Length: 348 bp
ATGCCATGTAGTGATGAATCATTGAACTCACAACATTTTCCTGGCAGGCAGTGGGATCCATTATTGTTGGACTATAGATTTGCTGTAGACCCCAATGGTGGTATTCCTAATAATCATCAACCGAATGGCCCTTCTGAAGTATCCGAACCAATAGAGAGTCCTCTACGTTATGGAATTTGTGATGATTGTATCAACACACATCTGTCAAGTGGCCATGCTGGTCATAGTAATGGGCTTTCAGTTCCAGATGGAAACCTGGGAATTCCTAGTGATGATGTTAATGCCAATATTCCAAGTGATTTCATAATTCCTCCTGCTGGTTTTCATAATTCCTCCTGCTGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.39

Weight (kDa)

4.42

Isoelectric Point (pI)

49.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 87
AclWI GGATC 2 cut(s) 50, 63
AcoI YGGCCR 1 cut(s) 211
AcsI RAATTY 2 cut(s) 174, 261
AcuI CTGAAG 1 cut(s) 156
AfiI CCNNNNNNNGG 3 cut(s) 98, 317, 339
AgsI TTSAA 1 cut(s) 25
AjnI CCWGG 2 cut(s) 40, 255
AlwI GGATC 2 cut(s) 50, 63
AoxI GGCC 2 cut(s) 127, 211
ApoI RAATTY 2 cut(s) 174, 261
ArsI GACNNNNNNTTYG 2 cut(s) 62, 94
AspS9I GGNCC 1 cut(s) 128
BalI TGGCCA 1 cut(s) 213
BamHI GGATCC 1 cut(s) 55
BccI CCATC 1 cut(s) 242
BciT130I CCWGG 2 cut(s) 42, 257
BciVI GTATCC 1 cut(s) 151
BfaI CTAG 1 cut(s) 267
BfmI CTRYAG 2 cut(s) 73, 84
BfuI GTATCC 1 cut(s) 151
Bme1390I CCNGG 2 cut(s) 42, 257
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 57
BmrFI CCNGG 2 cut(s) 42, 257
BsaJI CCNNGG 1 cut(s) 256
Bsc4I CCNNNNNNNGG 3 cut(s) 98, 317, 339
BseBI CCWGG 2 cut(s) 42, 257
BseDI CCNNGG 1 cut(s) 256
BseLI CCNNNNNNNGG 3 cut(s) 98, 317, 339
BshFI GGCC 2 cut(s) 129, 213
BslI CCNNNNNNNGG 3 cut(s) 98, 317, 339
BsnI GGCC 2 cut(s) 129, 213
Bsp143I GATC 1 cut(s) 55
BspANI GGCC 2 cut(s) 129, 213
BspLI GGNNCC 1 cut(s) 57
BspPI GGATC 2 cut(s) 50, 63
BssECI CCNNGG 1 cut(s) 256
BssMI GATC 1 cut(s) 55
Bst2UI CCWGG 2 cut(s) 42, 257
BstC8I GCNNGC 1 cut(s) 47
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstNI CCWGG 2 cut(s) 42, 257
BstSCI CCNGG 2 cut(s) 40, 255
BstSFI CTRYAG 2 cut(s) 73, 84
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
BsuI GTATCC 1 cut(s) 151
BsuRI GGCC 2 cut(s) 129, 213
BtsI GCAGTG 1 cut(s) 56
BtsIMutI CAGTG 1 cut(s) 56
Cac8I GCNNGC 1 cut(s) 47
Cfr13I GGNCC 1 cut(s) 128
CviAII CATG 2 cut(s) 6, 215
CviJI RGCY 3 cut(s) 129, 213, 235
CviKI_1 RGCY 3 cut(s) 129, 213, 235
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
EaeI YGGCCR 1 cut(s) 211
Eco57I CTGAAG 1 cut(s) 156
EcoRI GAATTC 1 cut(s) 261
EcoRII CCWGG 2 cut(s) 40, 255
FaeI CATG 2 cut(s) 9, 218
FaiI YATR 7 cut(s) 7, 75, 171, 216, 225, 305, 327
FatI CATG 2 cut(s) 5, 214
FblI GTMKAC 1 cut(s) 87
FspBI CTAG 1 cut(s) 267
HaeIII GGCC 2 cut(s) 129, 213
Hin1II CATG 2 cut(s) 9, 218
HinfI GANTC 2 cut(s) 17, 157
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 2 cut(s) 136, 145
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 1 cut(s) 88
HpyAV CCTTC 1 cut(s) 141
HpyCH4IV ACGT 1 cut(s) 166
HpySE526I ACGT 1 cut(s) 166
Hsp92II CATG 2 cut(s) 9, 218
Kzo9I GATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 267
MaeII ACGT 1 cut(s) 166
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MflI RGATCY 1 cut(s) 55
MlsI TGGCCA 1 cut(s) 213
MluCI AATT 4 cut(s) 174, 261, 306, 328
MluNI TGGCCA 1 cut(s) 213
MlyI GAGTC 1 cut(s) 166
MmeI TCCRAC 1 cut(s) 48
MnlI CCTC 3 cut(s) 171, 321, 343
Mox20I TGGCCA 1 cut(s) 213
MscI TGGCCA 1 cut(s) 213
MseI TTAA 1 cut(s) 279
MslI CAYNNNNRTG 1 cut(s) 228
Msp20I TGGCCA 1 cut(s) 213
MspR9I CCNGG 2 cut(s) 42, 257
MvaI CCWGG 2 cut(s) 42, 257
NdeII GATC 1 cut(s) 55
NlaIII CATG 2 cut(s) 9, 218
NlaIV GGNNCC 1 cut(s) 57
PfeI GAWTC 1 cut(s) 17
PleI GAGTC 1 cut(s) 165
PpsI GAGTC 1 cut(s) 165
Psp6I CCWGG 2 cut(s) 40, 255
PspGI CCWGG 2 cut(s) 40, 255
PspN4I GGNNCC 1 cut(s) 57
PspPI GGNCC 1 cut(s) 128
PsuI RGATCY 1 cut(s) 55
RseI CAYNNNNRTG 1 cut(s) 228
SaqAI TTAA 1 cut(s) 279
Sau3AI GATC 1 cut(s) 55
Sau96I GGNCC 1 cut(s) 128
SchI GAGTC 1 cut(s) 166
ScrFI CCNGG 2 cut(s) 42, 257
SetI ASST 2 cut(s) 169, 258
SfcI CTRYAG 2 cut(s) 73, 84
SmiMI CAYNNNNRTG 1 cut(s) 228
Sse9I AATT 4 cut(s) 174, 261, 306, 328
SspI AATATT 1 cut(s) 289
SspMI CTAG 1 cut(s) 267
StyD4I CCNGG 2 cut(s) 40, 255
TaiI ACGT 1 cut(s) 169
TasI AATT 4 cut(s) 174, 261, 306, 328
TfiI GAWTC 1 cut(s) 17
Tru1I TTAA 1 cut(s) 279
Tru9I TTAA 1 cut(s) 279
TscAI CASTG 1 cut(s) 56
TspDTI ATGAA 3 cut(s) 30, 292, 314
TspRI CASTG 1 cut(s) 56
XapI RAATTY 2 cut(s) 174, 261
XmiI GTMKAC 1 cut(s) 87
XspI CTAG 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.