Rh6DG255100

Protein of unknown function (DUF1517)

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
44548640 .. 44574973
26334 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG255100.1

Sequence Viewer

Length: 207 bp
ATGGTTCAGCACATAGGCTTGGAAATGTTATTCTTTTCTCTCTCGTTGAATTTTGATGATCAGCTTACAATTCTGGTGGCTACTGATGGAGAACAGAAGTTGCCCACCATCAATGGCACTCATGACTTGAAGAAAGCATTACATAAACTTGGAGCCATTTCCTCGAACAAAATAATGGTCAAAGAGAAGGACATAGATTCGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.57

Weight (kDa)

5.79

Isoelectric Point (pI)

25.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1517 PF07466 23 - 60 5.1e-07 Protein of unknown function (DUF1517)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 49
AgsI TTSAA 2 cut(s) 49, 130
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
ApoI RAATTY 1 cut(s) 49
ArsI GACNNNNNNTTYG 2 cut(s) 162, 194
BccI CCATC 2 cut(s) 80, 116
BclI TGATCA 1 cut(s) 58
BmiI GGNNCC 1 cut(s) 154
Bsp143I GATC 1 cut(s) 58
BspHI TCATGA 1 cut(s) 121
BspLI GGNNCC 1 cut(s) 154
BssMI GATC 1 cut(s) 58
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
CciI TCATGA 1 cut(s) 121
CspCI CAANNNNNGTGG 2 cut(s) 57, 92
CviAII CATG 1 cut(s) 122
CviJI RGCY 4 cut(s) 18, 64, 80, 155
CviKI_1 RGCY 4 cut(s) 18, 64, 80, 155
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
FaeI CATG 1 cut(s) 125
FaiI YATR 5 cut(s) 14, 123, 144, 194, 205
FatI CATG 1 cut(s) 121
FbaI TGATCA 1 cut(s) 58
Hin1II CATG 1 cut(s) 125
HinfI GANTC 1 cut(s) 197
Hpy188III TCNNGA 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 181
Hsp92II CATG 1 cut(s) 125
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 59
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 1 cut(s) 142
MluCI AATT 2 cut(s) 49, 69
MnlI CCTC 1 cut(s) 172
NdeII GATC 1 cut(s) 58
NlaIII CATG 1 cut(s) 125
NlaIV GGNNCC 1 cut(s) 154
PagI TCATGA 1 cut(s) 121
PfeI GAWTC 1 cut(s) 197
PspN4I GGNNCC 1 cut(s) 154
Sau3AI GATC 1 cut(s) 58
SetI ASST 1 cut(s) 66
SgeI CNNG 7 cut(s) 31, 55, 86, 134, 139, 161, 175
Sse9I AATT 2 cut(s) 49, 69
TaqI TCGA 1 cut(s) 164
TasI AATT 2 cut(s) 49, 69
TfiI GAWTC 1 cut(s) 197
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.