Rh4AG241600

Protein of unknown function (DUF1517)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0001780
Physical Location & Seq
Forward (+)
54839131 .. 54847834
8704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG241600.1

Sequence Viewer

Length: 474 bp
ATGGTTCAGCACACAGGCTTGGAAATGTTATTCTTTTCTCTCTCGTTGAATTTTGATGATCAGCTTACAATTCTGGTGGCTACTGATGGAGAACAGAAGTTGCCCACCATCAGTGGCACTCATGACTTGAAGAAAGCATTACATAAACTTGGAGCCATTTCCTCGAACAAAATAATGGCAGTGGGATCCATTATTGTTGGACTATTTGCTGTAGACCCCAATGGTGGTATTCCTAATAATCATCAACCGAATGGCCCTTCTGAAGTATCCGAACCAATAGAGAGTCCTCTACGTTATGGAATTTGTGATGATTGTATCAACACACATCTGTCAAGTGGCCATGCTGGTCATAGTAATGGGCTTTCAGTTCCAGATGGAAACCTGGGAATTCCTAGTGATGATGTTAATGCCAATATTCCAAGTGATTTCATAATTCCTCCTGCTGGTTTTCATAATTCCTCCTGCTGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1517

Protein Analysis

157

Amino Acids

16.6

Weight (kDa)

4.91

Isoelectric Point (pI)

35.53

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1517 PF07466 23 - 61 1.1e-06 Protein of unknown function (DUF1517)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 213
AclWI GGATC 2 cut(s) 180, 193
AcoI YGGCCR 1 cut(s) 337
AcsI RAATTY 3 cut(s) 49, 300, 387
AcuI CTGAAG 1 cut(s) 282
AfiI CCNNNNNNNGG 3 cut(s) 224, 443, 465
AgsI TTSAA 2 cut(s) 49, 130
AjnI CCWGG 1 cut(s) 381
AluBI AGCT 1 cut(s) 64
AluI AGCT 1 cut(s) 64
AlwI GGATC 2 cut(s) 180, 193
AoxI GGCC 2 cut(s) 253, 337
ApoI RAATTY 3 cut(s) 49, 300, 387
AspS9I GGNCC 1 cut(s) 254
BalI TGGCCA 1 cut(s) 339
BamHI GGATCC 1 cut(s) 185
BccI CCATC 3 cut(s) 80, 116, 368
BciT130I CCWGG 1 cut(s) 383
BciVI GTATCC 1 cut(s) 277
BclI TGATCA 1 cut(s) 58
BfaI CTAG 1 cut(s) 393
BfmI CTRYAG 1 cut(s) 210
BfuI GTATCC 1 cut(s) 277
Bme1390I CCNGG 1 cut(s) 383
BmgT120I GGNCC 1 cut(s) 254
BmiI GGNNCC 2 cut(s) 154, 187
BmrFI CCNGG 1 cut(s) 383
BsaJI CCNNGG 1 cut(s) 382
Bsc4I CCNNNNNNNGG 3 cut(s) 224, 443, 465
BseBI CCWGG 1 cut(s) 383
BseDI CCNNGG 1 cut(s) 382
BseLI CCNNNNNNNGG 3 cut(s) 224, 443, 465
BshFI GGCC 2 cut(s) 255, 339
BslI CCNNNNNNNGG 3 cut(s) 224, 443, 465
BsnI GGCC 2 cut(s) 255, 339
Bsp143I GATC 2 cut(s) 58, 185
BspANI GGCC 2 cut(s) 255, 339
BspHI TCATGA 1 cut(s) 121
BspLI GGNNCC 2 cut(s) 154, 187
BspPI GGATC 2 cut(s) 180, 193
BssECI CCNNGG 1 cut(s) 382
BssMI GATC 2 cut(s) 58, 185
Bst2UI CCWGG 1 cut(s) 383
BstKTI GATC 2 cut(s) 61, 188
BstMBI GATC 2 cut(s) 58, 185
BstNI CCWGG 1 cut(s) 383
BstSCI CCNGG 1 cut(s) 381
BstSFI CTRYAG 1 cut(s) 210
BstX2I RGATCY 1 cut(s) 185
BstYI RGATCY 1 cut(s) 185
BsuI GTATCC 1 cut(s) 277
BsuRI GGCC 2 cut(s) 255, 339
BtsI GCAGTG 1 cut(s) 186
BtsIMutI CAGTG 2 cut(s) 118, 186
CciI TCATGA 1 cut(s) 121
Cfr13I GGNCC 1 cut(s) 254
CspCI CAANNNNNGTGG 2 cut(s) 57, 92
CviAII CATG 2 cut(s) 122, 341
CviJI RGCY 7 cut(s) 18, 64, 80, 155, 255, 339, 361
CviKI_1 RGCY 7 cut(s) 18, 64, 80, 155, 255, 339, 361
DpnI GATC 2 cut(s) 60, 187
DpnII GATC 2 cut(s) 58, 185
EaeI YGGCCR 1 cut(s) 337
Eco57I CTGAAG 1 cut(s) 282
EcoRI GAATTC 1 cut(s) 387
EcoRII CCWGG 1 cut(s) 381
FaeI CATG 2 cut(s) 125, 344
FaiI YATR 7 cut(s) 123, 144, 297, 342, 351, 431, 453
FatI CATG 2 cut(s) 121, 340
FbaI TGATCA 1 cut(s) 58
FblI GTMKAC 1 cut(s) 213
FspBI CTAG 1 cut(s) 393
HaeIII GGCC 2 cut(s) 255, 339
Hin1II CATG 2 cut(s) 125, 344
HinfI GANTC 1 cut(s) 283
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 2 cut(s) 262, 271
Hpy188III TCNNGA 2 cut(s) 122, 371
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 267
HpyCH4IV ACGT 1 cut(s) 292
HpySE526I ACGT 1 cut(s) 292
Hsp92II CATG 2 cut(s) 125, 344
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 2 cut(s) 58, 185
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 8 cut(s) 59, 330, 368, 384, 395, 429, 451, 453
MaeI CTAG 1 cut(s) 393
MaeII ACGT 1 cut(s) 292
MalI GATC 2 cut(s) 60, 187
MboI GATC 2 cut(s) 58, 185
MboII GAAGA 1 cut(s) 142
MflI RGATCY 1 cut(s) 185
MlsI TGGCCA 1 cut(s) 339
MluCI AATT 6 cut(s) 49, 69, 300, 387, 432, 454
MluNI TGGCCA 1 cut(s) 339
MlyI GAGTC 1 cut(s) 292
MmeI TCCRAC 1 cut(s) 178
MnlI CCTC 4 cut(s) 172, 297, 447, 469
Mox20I TGGCCA 1 cut(s) 339
MscI TGGCCA 1 cut(s) 339
MseI TTAA 1 cut(s) 405
MslI CAYNNNNRTG 1 cut(s) 354
Msp20I TGGCCA 1 cut(s) 339
MspR9I CCNGG 1 cut(s) 383
MvaI CCWGG 1 cut(s) 383
NdeII GATC 2 cut(s) 58, 185
NlaIII CATG 2 cut(s) 125, 344
NlaIV GGNNCC 2 cut(s) 154, 187
PagI TCATGA 1 cut(s) 121
PleI GAGTC 1 cut(s) 291
PpsI GAGTC 1 cut(s) 291
Psp6I CCWGG 1 cut(s) 381
PspGI CCWGG 1 cut(s) 381
PspN4I GGNNCC 2 cut(s) 154, 187
PspPI GGNCC 1 cut(s) 254
PsuI RGATCY 1 cut(s) 185
RseI CAYNNNNRTG 1 cut(s) 354
SaqAI TTAA 1 cut(s) 405
Sau3AI GATC 2 cut(s) 58, 185
Sau96I GGNCC 1 cut(s) 254
SchI GAGTC 1 cut(s) 292
ScrFI CCNGG 1 cut(s) 383
SetI ASST 3 cut(s) 66, 295, 384
SfcI CTRYAG 1 cut(s) 210
SmiMI CAYNNNNRTG 1 cut(s) 354
Sse9I AATT 6 cut(s) 49, 69, 300, 387, 432, 454
SspI AATATT 1 cut(s) 415
SspMI CTAG 1 cut(s) 393
StyD4I CCNGG 1 cut(s) 381
TaiI ACGT 1 cut(s) 295
TaqI TCGA 1 cut(s) 164
TasI AATT 6 cut(s) 49, 69, 300, 387, 432, 454
Tru1I TTAA 1 cut(s) 405
Tru9I TTAA 1 cut(s) 405
TscAI CASTG 2 cut(s) 118, 186
TspDTI ATGAA 2 cut(s) 418, 440
TspRI CASTG 2 cut(s) 118, 186
XapI RAATTY 3 cut(s) 49, 300, 387
XmiI GTMKAC 1 cut(s) 213
XspI CTAG 1 cut(s) 393
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.