Rh4BG245000

Protein of unknown function (DUF1517)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0001780
Physical Location & Seq
Forward (+)
41210768 .. 41211246
479 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG245000.1

Sequence Viewer

Length: 213 bp
ATGGTTCAGCACACAGGCTTGGAAATGTTATTCTTTTCTCTCTCGTTGAATTTTGATGATCAGCTTACAATTCTGGTGGCTACTGATGGAGAACAGAAGTTGCCCACCATCAGTGGCACTCATGACTTGAAGAAAGCATTACATAAACTTGGAGCCATTTCCTCGAACAAAATAATGATGATTTCTTCCAAGGAAGCAAGCTGCTTGTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF1517

Protein Analysis

70

Amino Acids

7.64

Weight (kDa)

6.23

Isoelectric Point (pI)

26.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF1517 PF07466 23 - 60 1.2e-06 Protein of unknown function (DUF1517)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 49
AgsI TTSAA 2 cut(s) 49, 130
AluBI AGCT 2 cut(s) 64, 201
AluI AGCT 2 cut(s) 64, 201
ApeKI GCWGC 1 cut(s) 201
ApoI RAATTY 1 cut(s) 49
BbvI GCAGC 1 cut(s) 188
BccI CCATC 2 cut(s) 80, 116
BclI TGATCA 1 cut(s) 58
BisI GCNGC 1 cut(s) 202
BlsI GCNGC 1 cut(s) 203
BmiI GGNNCC 1 cut(s) 154
BsaJI CCNNGG 1 cut(s) 189
BseDI CCNNGG 1 cut(s) 189
BseXI GCAGC 1 cut(s) 188
Bsp143I GATC 1 cut(s) 58
BspHI TCATGA 1 cut(s) 121
BspLI GGNNCC 1 cut(s) 154
BssECI CCNNGG 1 cut(s) 189
BssMI GATC 1 cut(s) 58
BssT1I CCWWGG 1 cut(s) 189
BstC8I GCNNGC 1 cut(s) 199
BstKTI GATC 1 cut(s) 61
BstMBI GATC 1 cut(s) 58
BstV1I GCAGC 1 cut(s) 188
BtsIMutI CAGTG 1 cut(s) 118
Cac8I GCNNGC 1 cut(s) 199
CciI TCATGA 1 cut(s) 121
CspCI CAANNNNNGTGG 2 cut(s) 57, 92
CviAII CATG 1 cut(s) 122
CviJI RGCY 5 cut(s) 18, 64, 80, 155, 201
CviKI_1 RGCY 5 cut(s) 18, 64, 80, 155, 201
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
Eco130I CCWWGG 1 cut(s) 189
EcoT14I CCWWGG 1 cut(s) 189
ErhI CCWWGG 1 cut(s) 189
FaeI CATG 1 cut(s) 125
FaiI YATR 3 cut(s) 123, 144, 211
FatI CATG 1 cut(s) 121
FbaI TGATCA 1 cut(s) 58
Fnu4HI GCNGC 1 cut(s) 202
Fsp4HI GCNGC 1 cut(s) 202
GluI GCNGC 1 cut(s) 202
Hin1II CATG 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 122
Hsp92II CATG 1 cut(s) 125
Ksp22I TGATCA 1 cut(s) 58
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 59
Lsp1109I GCAGC 1 cut(s) 188
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 2 cut(s) 142, 177
MluCI AATT 2 cut(s) 49, 69
MnlI CCTC 1 cut(s) 172
NdeII GATC 1 cut(s) 58
NlaIII CATG 1 cut(s) 125
NlaIV GGNNCC 1 cut(s) 154
PagI TCATGA 1 cut(s) 121
PkrI GCNGC 1 cut(s) 203
PspN4I GGNNCC 1 cut(s) 154
SatI GCNGC 1 cut(s) 202
Sau3AI GATC 1 cut(s) 58
SetI ASST 2 cut(s) 66, 203
SgeI CNNG 9 cut(s) 27, 31, 55, 86, 134, 139, 161, 175, 202
Sse9I AATT 2 cut(s) 49, 69
StyI CCWWGG 1 cut(s) 189
TaqI TCGA 1 cut(s) 164
TasI AATT 2 cut(s) 49, 69
TscAI CASTG 1 cut(s) 118
TseI GCWGC 1 cut(s) 201
TspRI CASTG 1 cut(s) 118
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.