Prupe.3G259500_v2.0.a1

NAD(P)H-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp03
OG0000908
Physical Location & Seq
Reverse (-)
24615475 .. 24618100
2626 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.3G259500.2

Sequence Viewer

Length: 288 bp
ATGTTTAGCAAGTTTGAATTTGATGGGAAACTGAATCCTACTTTTGTGGAAGGGGCATTTAAGCTCCCATTATCAAGCATACGAGCATATCTAAAAAAGCCTATTACTCCCAGGTTCGTACACTTAGGTTCTGCAGGAGCTACCCGACCTGACAGGCCTGGACTTGATCTAAGTAAACAACCTCCTGCTGTTCGCTTAAACAAGGAATTGGATTTTATACTGACATTCAAGTTGAAGATGAAAAACAGAGGCTTCAACAGGAACATACATAAGCGACCAAGATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CIA30 NAD_binding_10

Protein Analysis

96

Amino Acids

10.96

Weight (kDa)

11.07

Isoelectric Point (pI)

37.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 17
AfaI GTAC 1 cut(s) 120
AgsI TTSAA 4 cut(s) 17, 229, 235, 256
AjnI CCWGG 2 cut(s) 110, 157
AluBI AGCT 2 cut(s) 64, 140
AluI AGCT 2 cut(s) 64, 140
AoxI GGCC 1 cut(s) 155
ApoI RAATTY 1 cut(s) 17
BccI CCATC 1 cut(s) 17
BciT130I CCWGG 2 cut(s) 112, 159
BfmI CTRYAG 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 112, 159
BmrFI CCNGG 2 cut(s) 112, 159
BsaJI CCNNGG 1 cut(s) 110
BseBI CCWGG 2 cut(s) 112, 159
BseDI CCNNGG 1 cut(s) 110
BshFI GGCC 1 cut(s) 157
BsnI GGCC 1 cut(s) 157
Bsp143I GATC 1 cut(s) 166
BspANI GGCC 1 cut(s) 157
BspMAI CTGCAG 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 110
BssMI GATC 1 cut(s) 166
Bst2UI CCWGG 2 cut(s) 112, 159
BstDEI CTNAG 2 cut(s) 124, 170
BstKTI GATC 1 cut(s) 169
BstMBI GATC 1 cut(s) 166
BstNI CCWGG 2 cut(s) 112, 159
BstSCI CCNGG 2 cut(s) 110, 157
BstSFI CTRYAG 1 cut(s) 132
BsuRI GGCC 1 cut(s) 157
Csp6I GTAC 1 cut(s) 119
CviJI RGCY 5 cut(s) 64, 100, 140, 157, 252
CviKI_1 RGCY 5 cut(s) 64, 100, 140, 157, 252
CviQI GTAC 1 cut(s) 119
DdeI CTNAG 2 cut(s) 124, 170
DpnI GATC 1 cut(s) 168
DpnII GATC 1 cut(s) 166
Eco147I AGGCCT 1 cut(s) 157
EcoRII CCWGG 2 cut(s) 110, 157
FaiI YATR 5 cut(s) 80, 88, 218, 266, 270
HaeIII GGCC 1 cut(s) 157
HinfI GANTC 1 cut(s) 34
Hpy166II GTNNAC 2 cut(s) 121, 176
Hpy8I GTNNAC 2 cut(s) 121, 176
HpyAV CCTTC 1 cut(s) 44
HpyCH4V TGCA 1 cut(s) 134
HpyF3I CTNAG 2 cut(s) 124, 170
Kzo9I GATC 1 cut(s) 166
LmnI GCTCC 2 cut(s) 69, 137
LpnPI CCDG 9 cut(s) 97, 120, 124, 139, 144, 162, 171, 198, 244
MalI GATC 1 cut(s) 168
MboI GATC 1 cut(s) 166
MboII GAAGA 1 cut(s) 247
MluCI AATT 2 cut(s) 17, 206
MnlI CCTC 2 cut(s) 192, 242
MseI TTAA 3 cut(s) 60, 197, 286
MspR9I CCNGG 2 cut(s) 112, 159
MvaI CCWGG 2 cut(s) 112, 159
NdeII GATC 1 cut(s) 166
PceI AGGCCT 1 cut(s) 157
PfeI GAWTC 1 cut(s) 34
Psp6I CCWGG 2 cut(s) 110, 157
PspGI CCWGG 2 cut(s) 110, 157
PstI CTGCAG 1 cut(s) 136
RsaI GTAC 1 cut(s) 120
RsaNI GTAC 1 cut(s) 119
SaqAI TTAA 3 cut(s) 60, 197, 286
Sau3AI GATC 1 cut(s) 166
ScrFI CCNGG 2 cut(s) 112, 159
SetI ASST 6 cut(s) 66, 116, 130, 142, 151, 184
SfcI CTRYAG 1 cut(s) 132
Sse9I AATT 2 cut(s) 17, 206
SseBI AGGCCT 1 cut(s) 157
StuI AGGCCT 1 cut(s) 157
StyD4I CCNGG 2 cut(s) 110, 157
TasI AATT 2 cut(s) 17, 206
TfiI GAWTC 1 cut(s) 34
Tru1I TTAA 3 cut(s) 60, 197, 286
Tru9I TTAA 3 cut(s) 60, 197, 286
TspDTI ATGAA 1 cut(s) 254
XapI RAATTY 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.