Prupe.7G223300_v2.0.a1

NAD(P)H-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0000908
Physical Location & Seq
Forward (+)
19903160 .. 19904278
1119 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G223300.1

Sequence Viewer

Length: 522 bp
ATGTTTATTGATGGGATTCAAAATTATAGCAAGTTTGAATTTGATGGGAAACTGAATCCTACTTTTGTGGAAGGGGCATTTAAGCTCCCATTATCAAGCATACGAGCATATCTAAAAGAGCCTATTACTCCCAGGCTCGTGCGCGGAGGTTCTGCAGGAATTACCCGACCTGACAGGCCTGGACTTGATCTAAGTAAACAACCTCCTGCTGTTCGCTTAAACAAGGAATTGGATTTTATCCTGACATTCAAGTTGAAGCAAGAGGAGGATTTAATACGGGAAAGTGGAATACCATATACAATTGTGAGGCCTTGTGCATTAACTGAGGAGCCTGCCGGAGCAAATCTCATTTTTGACCAAGGAGACAATATAACGGTTAAAAGTGTTGTGCCATTTAGTGAGCCATTTACAGTGGACCCTCAAAATCCACCCCCCGATAAGGACTACAATGTTTACTTTAAAACTTTGAAAGATGGAATTACAGGAAAGGAAATCCTCGAACAAGATCCTGTACCAGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CIA30 NAD_binding_10

Protein Analysis

174

Amino Acids

19.32

Weight (kDa)

5.0

Isoelectric Point (pI)

41.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 144
AciI CCGC 1 cut(s) 144
AclWI GGATC 1 cut(s) 500
AcsI RAATTY 1 cut(s) 38
AfaI GTAC 1 cut(s) 513
AfiI CCNNNNNNNGG 1 cut(s) 439
AgsI TTSAA 5 cut(s) 20, 38, 250, 256, 469
AjnI CCWGG 2 cut(s) 131, 178
AluBI AGCT 1 cut(s) 85
AluI AGCT 1 cut(s) 85
Alw26I GTCTC 1 cut(s) 357
AlwI GGATC 1 cut(s) 500
AoxI GGCC 2 cut(s) 176, 308
ApoI RAATTY 1 cut(s) 38
AspLEI GCGC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 415
AvaII GGWCC 1 cut(s) 415
BauI CACGAG 1 cut(s) 137
BccI CCATC 3 cut(s) 5, 38, 467
BciT130I CCWGG 2 cut(s) 133, 180
BcoDI GTCTC 1 cut(s) 357
BfmI CTRYAG 1 cut(s) 153
Bme1390I CCNGG 2 cut(s) 133, 180
Bme18I GGWCC 1 cut(s) 415
BmgT120I GGNCC 1 cut(s) 415
BmiI GGNNCC 2 cut(s) 330, 417
BmrFI CCNGG 2 cut(s) 133, 180
BplI GAGNNNNNCTC 2 cut(s) 330, 362
BsaJI CCNNGG 2 cut(s) 131, 358
Bsc4I CCNNNNNNNGG 1 cut(s) 439
Bse1I ACTGG 1 cut(s) 515
BseBI CCWGG 2 cut(s) 133, 180
BseDI CCNNGG 2 cut(s) 131, 358
BseLI CCNNNNNNNGG 1 cut(s) 439
BseMII CTCAG 1 cut(s) 315
BseNI ACTGG 1 cut(s) 515
BseRI GAGGAG 2 cut(s) 278, 341
Bsh1236I CGCG 1 cut(s) 144
BshFI GGCC 2 cut(s) 178, 310
BsiSI CCGG 1 cut(s) 336
BslI CCNNNNNNNGG 1 cut(s) 439
BsmAI GTCTC 1 cut(s) 357
BsnI GGCC 2 cut(s) 178, 310
Bsp143I GATC 2 cut(s) 187, 505
BspACI CCGC 1 cut(s) 144
BspANI GGCC 2 cut(s) 178, 310
BspCNI CTCAG 1 cut(s) 316
BspFNI CGCG 1 cut(s) 144
BspLI GGNNCC 2 cut(s) 330, 417
BspMAI CTGCAG 1 cut(s) 157
BspPI GGATC 1 cut(s) 500
BsrI ACTGG 1 cut(s) 515
BssECI CCNNGG 2 cut(s) 131, 358
BssMI GATC 2 cut(s) 187, 505
BssSI CACGAG 1 cut(s) 137
BssT1I CCWWGG 1 cut(s) 358
Bst2BI CACGAG 1 cut(s) 137
Bst2UI CCWGG 2 cut(s) 133, 180
Bst4CI ACNGT 2 cut(s) 376, 412
BstC8I GCNNGC 1 cut(s) 333
BstDEI CTNAG 2 cut(s) 191, 324
BstFNI CGCG 1 cut(s) 144
BstHHI GCGC 1 cut(s) 144
BstKTI GATC 2 cut(s) 190, 508
BstMAI GTCTC 1 cut(s) 357
BstMBI GATC 2 cut(s) 187, 505
BstNI CCWGG 2 cut(s) 133, 180
BstSCI CCNGG 2 cut(s) 131, 178
BstSFI CTRYAG 1 cut(s) 153
BstUI CGCG 1 cut(s) 144
BstX2I RGATCY 1 cut(s) 505
BstYI RGATCY 1 cut(s) 505
BsuRI GGCC 2 cut(s) 178, 310
BtsIMutI CAGTG 2 cut(s) 417, 522
Cac8I GCNNGC 1 cut(s) 333
CfoI GCGC 1 cut(s) 144
Cfr13I GGNCC 1 cut(s) 415
Csp6I GTAC 1 cut(s) 512
CviJI RGCY 7 cut(s) 85, 121, 136, 178, 310, 331, 403
CviKI_1 RGCY 7 cut(s) 85, 121, 136, 178, 310, 331, 403
CviQI GTAC 1 cut(s) 512
DdeI CTNAG 2 cut(s) 191, 324
DpnI GATC 2 cut(s) 189, 507
DpnII GATC 2 cut(s) 187, 505
DraI TTTAAA 1 cut(s) 460
Eco130I CCWWGG 1 cut(s) 358
Eco147I AGGCCT 2 cut(s) 178, 310
Eco47I GGWCC 1 cut(s) 415
EcoRII CCWGG 2 cut(s) 131, 178
EcoT14I CCWWGG 1 cut(s) 358
ErhI CCWWGG 1 cut(s) 358
FaiI YATR 6 cut(s) 27, 101, 109, 295, 297, 371
GlaI GCGC 1 cut(s) 143
HaeIII GGCC 2 cut(s) 178, 310
HapII CCGG 1 cut(s) 336
HhaI GCGC 1 cut(s) 144
Hin6I GCGC 1 cut(s) 142
HinP1I GCGC 1 cut(s) 142
HinfI GANTC 2 cut(s) 16, 55
HpaII CCGG 1 cut(s) 336
Hpy166II GTNNAC 3 cut(s) 197, 415, 454
Hpy188III TCNNGA 1 cut(s) 241
Hpy8I GTNNAC 3 cut(s) 197, 415, 454
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 2 cut(s) 376, 412
HpyCH4V TGCA 2 cut(s) 155, 317
HpyF3I CTNAG 2 cut(s) 191, 324
HspAI GCGC 1 cut(s) 142
Kzo9I GATC 2 cut(s) 187, 505
LmnI GCTCC 3 cut(s) 90, 328, 338
MalI GATC 2 cut(s) 189, 507
MboI GATC 2 cut(s) 187, 505
MfeI CAATTG 1 cut(s) 300
MflI RGATCY 1 cut(s) 505
MluCI AATT 6 cut(s) 22, 38, 159, 227, 300, 477
MnlI CCTC 8 cut(s) 140, 213, 256, 259, 300, 319, 429, 506
MseI TTAA 6 cut(s) 81, 218, 272, 320, 378, 459
MspI CCGG 1 cut(s) 336
MspR9I CCNGG 2 cut(s) 133, 180
MunI CAATTG 1 cut(s) 300
MvaI CCWGG 2 cut(s) 133, 180
MvnI CGCG 1 cut(s) 144
NdeII GATC 2 cut(s) 187, 505
NlaIV GGNNCC 2 cut(s) 330, 417
PceI AGGCCT 2 cut(s) 178, 310
PfeI GAWTC 2 cut(s) 16, 55
Psp6I CCWGG 2 cut(s) 131, 178
PspGI CCWGG 2 cut(s) 131, 178
PspN4I GGNNCC 2 cut(s) 330, 417
PspPI GGNCC 1 cut(s) 415
PstI CTGCAG 1 cut(s) 157
PsuI RGATCY 1 cut(s) 505
RsaI GTAC 1 cut(s) 513
RsaNI GTAC 1 cut(s) 512
SaqAI TTAA 6 cut(s) 81, 218, 272, 320, 378, 459
Sau3AI GATC 2 cut(s) 187, 505
Sau96I GGNCC 1 cut(s) 415
ScrFI CCNGG 2 cut(s) 133, 180
SetI ASST 4 cut(s) 87, 151, 172, 205
SfcI CTRYAG 1 cut(s) 153
SinI GGWCC 1 cut(s) 415
Sse9I AATT 6 cut(s) 22, 38, 159, 227, 300, 477
SseBI AGGCCT 2 cut(s) 178, 310
SsiI CCGC 1 cut(s) 144
StuI AGGCCT 2 cut(s) 178, 310
StyD4I CCNGG 2 cut(s) 131, 178
StyI CCWWGG 1 cut(s) 358
TaaI ACNGT 2 cut(s) 376, 412
TaqI TCGA 1 cut(s) 498
TasI AATT 6 cut(s) 22, 38, 159, 227, 300, 477
TfiI GAWTC 2 cut(s) 16, 55
Tru1I TTAA 6 cut(s) 81, 218, 272, 320, 378, 459
Tru9I TTAA 6 cut(s) 81, 218, 272, 320, 378, 459
TscAI CASTG 2 cut(s) 417, 522
TspRI CASTG 2 cut(s) 417, 522
VpaK11BI GGWCC 1 cut(s) 415
XapI RAATTY 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.