Rmu_sc0003291.1_g000002

NAD(P)H-binding

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003291.1
OG0000908
Physical Location & Seq
Forward (+)
10068 .. 10930
863 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003291.1_g000002.1.cds

Sequence Viewer

Length: 345 bp
atgctgcagggtatcaagttctttgaaccagaggtgggaagaattgattgcttacattctgtatctggaatcaagggagatttgcctgaaaaggtggagtacgttgggatgaaaaatttgattaatgctctaaaacaaagtgttggacttcaaaatggaaagctactatttggatatgaaggtaataattatagggaattgacttggggagctttagatgatgttgtgatgggtggagtgagtgaaagtacatttctgatcgacccaaatggcagtgaaaatggtggaccaactggactttttaaaggtccgttctttgtaaactctagacttttggttgtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CIA30 NAD_binding_10

Protein Analysis

114

Amino Acids

12.38

Weight (kDa)

5.04

Isoelectric Point (pI)

19.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 115
AfaI GTAC 2 cut(s) 101, 250
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 2 cut(s) 26, 152
AluBI AGCT 2 cut(s) 163, 212
AluI AGCT 2 cut(s) 163, 212
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 115
AseI ATTAAT 1 cut(s) 123
AspS9I GGNCC 2 cut(s) 287, 308
AvaII GGWCC 2 cut(s) 287, 308
BccI CCATC 1 cut(s) 223
BfaI CTAG 2 cut(s) 327, 343
BfmI CTRYAG 1 cut(s) 5
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme18I GGWCC 2 cut(s) 287, 308
BmgT120I GGNCC 2 cut(s) 287, 308
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 298
BseGI GGATG 1 cut(s) 114
BseLI CCNNNNNNNGG 1 cut(s) 35
BseNI ACTGG 1 cut(s) 298
BslI CCNNNNNNNGG 1 cut(s) 35
Bsp143I GATC 1 cut(s) 258
BspMAI CTGCAG 1 cut(s) 9
BsrI ACTGG 1 cut(s) 298
BssMI GATC 1 cut(s) 258
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 1 cut(s) 261
BstMBI GATC 1 cut(s) 258
BstSFI CTRYAG 1 cut(s) 5
BtsCI GGATG 1 cut(s) 114
BtsI GCAGTG 1 cut(s) 280
BtsIMutI CAGTG 1 cut(s) 280
Cfr13I GGNCC 2 cut(s) 287, 308
Csp6I GTAC 2 cut(s) 100, 249
CviJI RGCY 2 cut(s) 163, 212
CviKI_1 RGCY 2 cut(s) 163, 212
CviQI GTAC 2 cut(s) 100, 249
DpnI GATC 1 cut(s) 260
DpnII GATC 1 cut(s) 258
DraI TTTAAA 1 cut(s) 304
Eco47I GGWCC 2 cut(s) 287, 308
FaiI YATR 2 cut(s) 177, 192
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 1 cut(s) 121
Fsp4HI GCNGC 1 cut(s) 5
FspBI CTAG 2 cut(s) 327, 343
GluI GCNGC 1 cut(s) 5
HinfI GANTC 1 cut(s) 69
Hpy166II GTNNAC 2 cut(s) 287, 322
Hpy188I TCNGA 1 cut(s) 258
Hpy188III TCNNGA 2 cut(s) 66, 327
Hpy8I GTNNAC 2 cut(s) 287, 322
HpyAV CCTTC 1 cut(s) 173
HpyCH4IV ACGT 1 cut(s) 102
HpyCH4V TGCA 1 cut(s) 7
HpySE526I ACGT 1 cut(s) 102
Kzo9I GATC 1 cut(s) 258
LmnI GCTCC 1 cut(s) 209
LpnPI CCDG 4 cut(s) 42, 51, 99, 279
MaeI CTAG 2 cut(s) 327, 343
MaeII ACGT 1 cut(s) 102
MalI GATC 1 cut(s) 260
MboI GATC 1 cut(s) 258
MboII GAAGA 1 cut(s) 51
MluCI AATT 4 cut(s) 42, 115, 187, 197
MmeI TCCRAC 1 cut(s) 124
MnlI CCTC 1 cut(s) 25
MseI TTAA 2 cut(s) 123, 303
NdeII GATC 1 cut(s) 258
PfeI GAWTC 1 cut(s) 69
PkrI GCNGC 1 cut(s) 6
PshBI ATTAAT 1 cut(s) 123
PspPI GGNCC 2 cut(s) 287, 308
PstI CTGCAG 1 cut(s) 9
RsaI GTAC 2 cut(s) 101, 250
RsaNI GTAC 2 cut(s) 100, 249
SaqAI TTAA 2 cut(s) 123, 303
SatI GCNGC 1 cut(s) 5
Sau3AI GATC 1 cut(s) 258
Sau96I GGNCC 2 cut(s) 287, 308
SetI ASST 7 cut(s) 36, 96, 105, 165, 184, 214, 310
SfcI CTRYAG 1 cut(s) 5
SgeI CNNG 9 cut(s) 20, 28, 41, 78, 85, 98, 216, 306, 339
SinI GGWCC 2 cut(s) 287, 308
Sse9I AATT 4 cut(s) 42, 115, 187, 197
SspMI CTAG 2 cut(s) 327, 343
TaiI ACGT 1 cut(s) 105
TaqI TCGA 1 cut(s) 261
TasI AATT 4 cut(s) 42, 115, 187, 197
TatI WGTACW 1 cut(s) 248
TfiI GAWTC 1 cut(s) 69
Tru1I TTAA 2 cut(s) 123, 303
Tru9I TTAA 2 cut(s) 123, 303
TscAI CASTG 1 cut(s) 280
TseI GCWGC 1 cut(s) 4
TspDTI ATGAA 2 cut(s) 125, 192
TspGWI ACGGA 1 cut(s) 300
TspRI CASTG 1 cut(s) 280
VpaK11BI GGWCC 2 cut(s) 287, 308
VspI ATTAAT 1 cut(s) 123
XapI RAATTY 1 cut(s) 115
XbaI TCTAGA 1 cut(s) 326
XspI CTAG 2 cut(s) 327, 343
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.