pycom06g15020

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr6
Physical Location & Seq
Reverse (-)
19612060 .. 19612287
228 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom06g15020.1

Sequence Viewer

Length: 228 bp
ATGAACACTACCCGATGTTGGTACTATGAAGACCCGTACATTTTGGCAACTATGGCCAAACAAATTTTCTACATCGAAGATCTAAAGGCCAGAAGGGGATGGAAAGTTGTTCAGATGATTGATCACAAAAGGGTGTATGATATTGCGGACCGAGATCCTGACGACAATGACGATGATGACAACTTTGCTGACCAACTCCTCAAAACTTCGACACAAATTGGTGCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

76

Amino Acids

8.92

Weight (kDa)

4.56

Isoelectric Point (pI)

41.23

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4216 PF13952 2 - 37 1.3e-09 Domain of unknown function (DUF4216)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 146
AclWI GGATC 1 cut(s) 149
AcoI YGGCCR 1 cut(s) 54
AcsI RAATTY 1 cut(s) 63
AfaI GTAC 2 cut(s) 23, 38
AfiI CCNNNNNNNGG 1 cut(s) 18
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AlwI GGATC 1 cut(s) 149
AoxI GGCC 2 cut(s) 54, 87
ApoI RAATTY 1 cut(s) 63
AspS9I GGNCC 1 cut(s) 148
AvaII GGWCC 1 cut(s) 148
BalI TGGCCA 1 cut(s) 56
BbsI GAAGAC 1 cut(s) 36
BccI CCATC 1 cut(s) 93
BclI TGATCA 1 cut(s) 121
BglII AGATCT 1 cut(s) 79
Bme18I GGWCC 1 cut(s) 148
BmgT120I GGNCC 1 cut(s) 148
BpiI GAAGAC 1 cut(s) 36
Bsc4I CCNNNNNNNGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 104
BseLI CCNNNNNNNGG 1 cut(s) 18
BseRI GAGGAG 1 cut(s) 188
BshFI GGCC 2 cut(s) 56, 89
BslI CCNNNNNNNGG 1 cut(s) 18
BsnI GGCC 2 cut(s) 56, 89
Bsp143I GATC 3 cut(s) 79, 121, 154
BspACI CCGC 1 cut(s) 146
BspANI GGCC 2 cut(s) 56, 89
BspPI GGATC 1 cut(s) 149
BssMI GATC 3 cut(s) 79, 121, 154
BstF5I GGATG 1 cut(s) 104
BstKTI GATC 3 cut(s) 82, 124, 157
BstMBI GATC 3 cut(s) 79, 121, 154
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstV2I GAAGAC 1 cut(s) 36
BstX2I RGATCY 2 cut(s) 79, 154
BstYI RGATCY 2 cut(s) 79, 154
BsuRI GGCC 2 cut(s) 56, 89
BtsCI GGATG 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 148
CpoI CGGWCCG 1 cut(s) 148
Csp6I GTAC 2 cut(s) 22, 37
CspI CGGWCCG 1 cut(s) 148
CviJI RGCY 2 cut(s) 56, 89
CviKI_1 RGCY 2 cut(s) 56, 89
CviQI GTAC 2 cut(s) 22, 37
DpnI GATC 3 cut(s) 81, 123, 156
DpnII GATC 3 cut(s) 79, 121, 154
EaeI YGGCCR 1 cut(s) 54
Eco47I GGWCC 1 cut(s) 148
FaiI YATR 4 cut(s) 27, 53, 138, 226
FbaI TGATCA 1 cut(s) 121
FokI GGATG 1 cut(s) 111
HaeIII GGCC 2 cut(s) 56, 89
Hpy188I TCNGA 1 cut(s) 114
Hpy188III TCNNGA 1 cut(s) 158
HpyAV CCTTC 1 cut(s) 87
HpyCH4V TGCA 1 cut(s) 224
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 3 cut(s) 79, 121, 154
LpnPI CCDG 2 cut(s) 103, 171
MalI GATC 3 cut(s) 81, 123, 156
MboI GATC 3 cut(s) 79, 121, 154
MboII GAAGA 2 cut(s) 41, 89
MflI RGATCY 2 cut(s) 79, 154
MlsI TGGCCA 1 cut(s) 56
MluCI AATT 2 cut(s) 63, 216
MluNI TGGCCA 1 cut(s) 56
MnlI CCTC 1 cut(s) 209
Mox20I TGGCCA 1 cut(s) 56
MscI TGGCCA 1 cut(s) 56
Msp20I TGGCCA 1 cut(s) 56
MwoI GCNNNNNNNGC 1 cut(s) 53
NdeII GATC 3 cut(s) 79, 121, 154
PcsI WCGNNNNNNNCGW 1 cut(s) 168
PspPI GGNCC 1 cut(s) 148
PsuI RGATCY 2 cut(s) 79, 154
RsaI GTAC 2 cut(s) 23, 38
RsaNI GTAC 2 cut(s) 22, 37
Rsr2I CGGWCCG 1 cut(s) 148
RsrII CGGWCCG 1 cut(s) 148
Sau3AI GATC 3 cut(s) 79, 121, 154
Sau96I GGNCC 1 cut(s) 148
SgeI CNNG 5 cut(s) 24, 46, 102, 164, 170
SinI GGWCC 1 cut(s) 148
Sse9I AATT 2 cut(s) 63, 216
SsiI CCGC 1 cut(s) 146
TaqI TCGA 2 cut(s) 75, 209
TaqII GACCGA 1 cut(s) 165
TasI AATT 2 cut(s) 63, 216
TspDTI ATGAA 2 cut(s) 17, 42
VpaK11BI GGWCC 1 cut(s) 148
XapI RAATTY 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.