pycom14g06730

source UniProtKB

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
Physical Location & Seq
Forward (+)
6730586 .. 6730987
402 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g06730.1

Sequence Viewer

Length: 402 bp
ATGGCAAAACAAATTGTGTATCTAGATGACCTTAAAGCTAGGAGGGGTTGGAAAGTTGTTCAAAAGATCGATCATAGGAACGTGTATGCTATACCAGAACAAGACCGTATTGATGATGACATCGACAATGTTGTTGACCAACGTCTTGAATCTTCGATGGAACGTGGTGCAAAAACACTCCGAGATACTAATCTTATCCAAGAACCATTTCAAATAGAAGGAGTATCTTCAATTGAAATACCGATTCAGTCGATCACAATTGACCTCGGTAAAATTCCACGATACGATGGTCCAATGCGCACAAACGACGATGGTGACGTACCTATCGATGATGAAGAATGGGACACTGAAAATGATGATAGCGACGAAAGTGAAAGTTATTATAGTTCGGATGAAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

134

Amino Acids

15.36

Weight (kDa)

4.14

Isoelectric Point (pI)

45.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 299
AcsI RAATTY 1 cut(s) 273
AfaI GTAC 1 cut(s) 321
AflIII ACRYGT 1 cut(s) 81
AgsI TTSAA 5 cut(s) 62, 149, 212, 231, 236
AjuI GAANNNNNNNTTGG 2 cut(s) 192, 224
AluBI AGCT 1 cut(s) 38
AluI AGCT 1 cut(s) 38
ApoI RAATTY 1 cut(s) 273
Asp700I GAANNNNTTC 1 cut(s) 207
AspLEI GCGC 1 cut(s) 300
AspS9I GGNCC 1 cut(s) 290
AsuHPI GGTGA 1 cut(s) 326
AvaII GGWCC 1 cut(s) 290
BaeI ACNNNNGTAYC 2 cut(s) 274, 307
BccI CCATC 3 cut(s) 151, 281, 305
BfaI CTAG 2 cut(s) 23, 39
Bme18I GGWCC 1 cut(s) 290
BmgT120I GGNCC 1 cut(s) 290
BoxI GACNNNNGTC 1 cut(s) 141
Bsa29I ATCGAT 2 cut(s) 69, 327
BsaBI GATNNNNATC 1 cut(s) 189
BsaJI CCNNGG 1 cut(s) 265
Bse8I GATNNNNATC 1 cut(s) 189
BseCI ATCGAT 2 cut(s) 69, 327
BseDI CCNNGG 1 cut(s) 265
BseGI GGATG 1 cut(s) 397
BseJI GATNNNNATC 1 cut(s) 189
BshVI ATCGAT 2 cut(s) 69, 327
BslFI GGGAC 1 cut(s) 356
BsmFI GGGAC 1 cut(s) 356
Bsp143I GATC 3 cut(s) 66, 70, 252
BspDI ATCGAT 2 cut(s) 69, 327
BssECI CCNNGG 1 cut(s) 265
BssMI GATC 3 cut(s) 66, 70, 252
Bst4CI ACNGT 1 cut(s) 107
BstF5I GGATG 1 cut(s) 397
BstHHI GCGC 1 cut(s) 300
BstKTI GATC 3 cut(s) 69, 73, 255
BstMBI GATC 3 cut(s) 66, 70, 252
BstPAI GACNNNNGTC 1 cut(s) 141
Bsu15I ATCGAT 2 cut(s) 69, 327
BsuTUI ATCGAT 2 cut(s) 69, 327
BtsCI GGATG 1 cut(s) 397
BtsIMutI CAGTG 1 cut(s) 345
CfoI GCGC 1 cut(s) 300
Cfr13I GGNCC 1 cut(s) 290
ClaI ATCGAT 2 cut(s) 69, 327
Csp6I GTAC 1 cut(s) 320
CviJI RGCY 1 cut(s) 38
CviKI_1 RGCY 1 cut(s) 38
CviQI GTAC 1 cut(s) 320
DpnI GATC 3 cut(s) 68, 72, 254
DpnII GATC 3 cut(s) 66, 70, 252
Eco47I GGWCC 1 cut(s) 290
FaiI YATR 4 cut(s) 75, 87, 92, 384
FaqI GGGAC 1 cut(s) 356
FspAI RTGCGCAY 1 cut(s) 299
FspBI CTAG 2 cut(s) 23, 39
FspI TGCGCA 1 cut(s) 299
GlaI GCGC 1 cut(s) 299
HhaI GCGC 1 cut(s) 300
Hin6I GCGC 1 cut(s) 298
HinP1I GCGC 1 cut(s) 298
HincII GTYRAC 1 cut(s) 136
HindII GTYRAC 1 cut(s) 136
HinfI GANTC 2 cut(s) 149, 244
HphI GGTGA 1 cut(s) 326
Hpy166II GTNNAC 1 cut(s) 136
Hpy188I TCNGA 2 cut(s) 182, 391
Hpy188III TCNNGA 2 cut(s) 23, 146
Hpy8I GTNNAC 1 cut(s) 136
Hpy99I CGWCG 2 cut(s) 311, 368
HpyAV CCTTC 1 cut(s) 212
HpyCH4III ACNGT 1 cut(s) 107
HpyCH4IV ACGT 4 cut(s) 81, 142, 163, 318
HpyCH4V TGCA 1 cut(s) 170
HpySE526I ACGT 4 cut(s) 81, 142, 163, 318
HspAI GCGC 1 cut(s) 298
Kzo9I GATC 3 cut(s) 66, 70, 252
LpnPI CCDG 1 cut(s) 108
MaeI CTAG 2 cut(s) 23, 39
MaeII ACGT 4 cut(s) 81, 142, 163, 318
MaeIII GTNAC 1 cut(s) 314
MalI GATC 3 cut(s) 68, 72, 254
MboI GATC 3 cut(s) 66, 70, 252
MboII GAAGA 3 cut(s) 144, 219, 347
MfeI CAATTG 2 cut(s) 231, 258
MluCI AATT 4 cut(s) 12, 231, 258, 273
MmeI TCCRAC 1 cut(s) 29
MnlI CCTC 2 cut(s) 36, 275
MroXI GAANNNNTTC 1 cut(s) 207
MseI TTAA 2 cut(s) 33, 400
MunI CAATTG 2 cut(s) 231, 258
NdeII GATC 3 cut(s) 66, 70, 252
NmuCI GTSAC 1 cut(s) 314
NsbI TGCGCA 1 cut(s) 299
PcsI WCGNNNNNNNCGW 2 cut(s) 315, 324
PdmI GAANNNNTTC 1 cut(s) 207
PfeI GAWTC 2 cut(s) 149, 244
PshAI GACNNNNGTC 1 cut(s) 141
PspPI GGNCC 1 cut(s) 290
RsaI GTAC 1 cut(s) 321
RsaNI GTAC 1 cut(s) 320
SaqAI TTAA 2 cut(s) 33, 400
Sau3AI GATC 3 cut(s) 66, 70, 252
Sau96I GGNCC 1 cut(s) 290
SetI ASST 8 cut(s) 33, 40, 84, 145, 166, 267, 321, 325
SinI GGWCC 1 cut(s) 290
Sse9I AATT 4 cut(s) 12, 231, 258, 273
SspMI CTAG 2 cut(s) 23, 39
TaaI ACNGT 1 cut(s) 107
TaiI ACGT 4 cut(s) 84, 145, 166, 321
TaqI TCGA 5 cut(s) 69, 123, 155, 251, 327
TasI AATT 4 cut(s) 12, 231, 258, 273
TfiI GAWTC 2 cut(s) 149, 244
Tru1I TTAA 2 cut(s) 33, 400
Tru9I TTAA 2 cut(s) 33, 400
TscAI CASTG 1 cut(s) 352
TseFI GTSAC 1 cut(s) 314
Tsp45I GTSAC 1 cut(s) 314
TspDTI ATGAA 1 cut(s) 348
TspRI CASTG 1 cut(s) 352
VpaK11BI GGWCC 1 cut(s) 290
XapI RAATTY 1 cut(s) 273
XbaI TCTAGA 1 cut(s) 22
XmnI GAANNNNTTC 1 cut(s) 207
XspI CTAG 2 cut(s) 23, 39
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.