Rh2CG425500

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
57937419 .. 57938262
844 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG425500.1

Sequence Viewer

Length: 624 bp
ATGCAGAATAGTGGGATCATGGTTCCAAGATCACATAATAACAGAGAAAGTGACTTTTACTGGCAGTTGGTTAGCATCGTCAAATTAGATTTTCCGTACGGCTATTCAGTTTTTCTATCCAAAGGTGAGTGGTTTAATACAATAAATACAAAGAAGAGAATAAGAACCATTCGTGATTACCATTTGACATCGTTGAATGTAAACGATAAATGGTACGTAAAAGATCCGTATATACTTGCAAAGCAATCACAACAAGTGTTTTACCTTGATGATCCGAAGTTAGGTGCTAGTTGGAAAGTCATTCAAAAGATTCGACACAGACATATATGGGATGTGCTTGAGAATGAAGAATCTCATGATACCGAAACAAGTTATGTTGATGGGGTAGACCAAGAAGAAGAGGCTAGCAATATCACTCATCCCATTGAAGAGAATGTTAATTCAATGCCAACATTTTGTGGAAGAGATGTCGAACCTGAAATTGTTGGTTTGAGTAGCAAAGATATTGAACAAAGCAACATAAGTGACAATGATTTTATCGATTATAATCCTCTAGATGAGGAATTACTATCAGGAGATGAAGATAACACTCGAGAAAGTGATGGATACAGTGACTTTGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

207

Amino Acids

24.2

Weight (kDa)

4.53

Isoelectric Point (pI)

48.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF4216 PF13952 29 - 101 1.1e-16 Domain of unknown function (DUF4216)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 546
AccI GTMKAC 1 cut(s) 387
AclWI GGATC 3 cut(s) 23, 218, 266
AfaI GTAC 2 cut(s) 98, 215
AfiI CCNNNNNNNGG 1 cut(s) 281
AgsI TTSAA 5 cut(s) 196, 305, 428, 444, 509
AlwI GGATC 3 cut(s) 23, 218, 266
Ama87I CYCGRG 1 cut(s) 591
AsuHPI GGTGA 1 cut(s) 137
AsuNHI GCTAGC 1 cut(s) 404
AvaI CYCGRG 1 cut(s) 591
BccI CCATC 2 cut(s) 374, 596
BceAI ACGGC 1 cut(s) 115
BciVI GTATCC 1 cut(s) 599
BfaI CTAG 3 cut(s) 288, 405, 554
BfuI GTATCC 1 cut(s) 599
BmeT110I CYCGRG 1 cut(s) 591
BmiI GGNNCC 1 cut(s) 24
BmsI GCATC 1 cut(s) 84
BmtI GCTAGC 1 cut(s) 408
BpuEI CTTGAG 1 cut(s) 359
Bsa29I ATCGAT 1 cut(s) 540
BsaAI YACGTR 1 cut(s) 217
BsaBI GATNNNNATC 1 cut(s) 546
Bsc4I CCNNNNNNNGG 1 cut(s) 281
Bse1I ACTGG 1 cut(s) 65
Bse8I GATNNNNATC 1 cut(s) 546
BseCI ATCGAT 1 cut(s) 540
BseGI GGATG 2 cut(s) 337, 418
BseJI GATNNNNATC 1 cut(s) 546
BseLI CCNNNNNNNGG 1 cut(s) 281
BseNI ACTGG 1 cut(s) 65
BshVI ATCGAT 1 cut(s) 540
BsiHKCI CYCGRG 1 cut(s) 591
BsiWI CGTACG 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 281
BsoBI CYCGRG 1 cut(s) 591
Bsp143I GATC 4 cut(s) 15, 29, 223, 271
BspDI ATCGAT 1 cut(s) 540
BspHI TCATGA 1 cut(s) 355
BspLI GGNNCC 1 cut(s) 24
BspOI GCTAGC 1 cut(s) 408
BspPI GGATC 3 cut(s) 23, 218, 266
BsrI ACTGG 1 cut(s) 65
BssMI GATC 4 cut(s) 15, 29, 223, 271
Bst4CI ACNGT 1 cut(s) 611
Bst6I CTCTTC 4 cut(s) 149, 393, 423, 457
BstBAI YACGTR 1 cut(s) 217
BstC8I GCNNGC 1 cut(s) 406
BstF5I GGATG 2 cut(s) 337, 418
BstKTI GATC 4 cut(s) 18, 32, 226, 274
BstMBI GATC 4 cut(s) 15, 29, 223, 271
BstSNI TACGTA 1 cut(s) 217
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
Bsu15I ATCGAT 1 cut(s) 540
BsuI GTATCC 1 cut(s) 599
BsuTUI ATCGAT 1 cut(s) 540
BtsCI GGATG 2 cut(s) 337, 418
BtsIMutI CAGTG 1 cut(s) 616
Cac8I GCNNGC 1 cut(s) 406
CciI TCATGA 1 cut(s) 355
ClaI ATCGAT 1 cut(s) 540
Csp6I GTAC 2 cut(s) 97, 214
CviAII CATG 2 cut(s) 19, 356
CviJI RGCY 2 cut(s) 102, 404
CviKI_1 RGCY 2 cut(s) 102, 404
CviQI GTAC 2 cut(s) 97, 214
DpnI GATC 4 cut(s) 17, 31, 225, 273
DpnII GATC 4 cut(s) 15, 29, 223, 271
Eam1104I CTCTTC 4 cut(s) 149, 393, 423, 457
EarI CTCTTC 4 cut(s) 149, 393, 423, 457
Eco105I TACGTA 1 cut(s) 217
Eco88I CYCGRG 1 cut(s) 591
FaeI CATG 2 cut(s) 22, 359
FatI CATG 2 cut(s) 18, 355
FblI GTMKAC 1 cut(s) 387
FokI GGATG 2 cut(s) 344, 405
FspBI CTAG 3 cut(s) 288, 405, 554
Hin1II CATG 2 cut(s) 22, 359
HinfI GANTC 2 cut(s) 310, 350
HphI GGTGA 1 cut(s) 137
Hpy166II GTNNAC 2 cut(s) 202, 388
Hpy188I TCNGA 1 cut(s) 276
Hpy188III TCNNGA 5 cut(s) 173, 356, 554, 573, 593
Hpy8I GTNNAC 2 cut(s) 202, 388
HpyCH4III ACNGT 1 cut(s) 611
HpyCH4IV ACGT 1 cut(s) 216
HpyCH4V TGCA 2 cut(s) 4, 239
HpySE526I ACGT 1 cut(s) 216
Hsp92II CATG 2 cut(s) 22, 359
Kzo9I GATC 4 cut(s) 15, 29, 223, 271
LpnPI CCDG 3 cut(s) 46, 489, 558
LweI GCATC 1 cut(s) 84
MaeI CTAG 3 cut(s) 288, 405, 554
MaeII ACGT 1 cut(s) 216
MaeIII GTNAC 3 cut(s) 50, 524, 611
MalI GATC 4 cut(s) 17, 31, 225, 273
MboI GATC 4 cut(s) 15, 29, 223, 271
MboII GAAGA 7 cut(s) 166, 359, 407, 410, 440, 474, 593
MflI RGATCY 1 cut(s) 223
MluCI AATT 4 cut(s) 83, 439, 480, 563
MmeI TCCRAC 1 cut(s) 272
MnlI CCTC 3 cut(s) 394, 553, 561
MseI TTAA 3 cut(s) 135, 438, 622
NdeII GATC 4 cut(s) 15, 29, 223, 271
NheI GCTAGC 1 cut(s) 404
NlaIII CATG 2 cut(s) 22, 359
NlaIV GGNNCC 1 cut(s) 24
NmuCI GTSAC 3 cut(s) 50, 524, 611
PaeR7I CTCGAG 1 cut(s) 591
PagI TCATGA 1 cut(s) 355
PfeI GAWTC 2 cut(s) 310, 350
Pfl23II CGTACG 1 cut(s) 96
Ppu21I YACGTR 1 cut(s) 217
PsiI TTATAA 1 cut(s) 546
PspLI CGTACG 1 cut(s) 96
PspN4I GGNNCC 1 cut(s) 24
PsuI RGATCY 1 cut(s) 223
RsaI GTAC 2 cut(s) 98, 215
RsaNI GTAC 2 cut(s) 97, 214
SaqAI TTAA 3 cut(s) 135, 438, 622
Sau3AI GATC 4 cut(s) 15, 29, 223, 271
SetI ASST 5 cut(s) 127, 219, 267, 286, 478
SfaNI GCATC 1 cut(s) 84
Sfr274I CTCGAG 1 cut(s) 591
SlaI CTCGAG 1 cut(s) 591
SmlI CTYRAG 2 cut(s) 338, 591
SmoI CTYRAG 2 cut(s) 338, 591
SnaBI TACGTA 1 cut(s) 217
Sse9I AATT 4 cut(s) 83, 439, 480, 563
SspMI CTAG 3 cut(s) 288, 405, 554
TaaI ACNGT 1 cut(s) 611
TaiI ACGT 1 cut(s) 219
TaqI TCGA 4 cut(s) 313, 471, 540, 592
TasI AATT 4 cut(s) 83, 439, 480, 563
TfiI GAWTC 2 cut(s) 310, 350
Tru1I TTAA 3 cut(s) 135, 438, 622
Tru9I TTAA 3 cut(s) 135, 438, 622
TscAI CASTG 1 cut(s) 616
TseFI GTSAC 3 cut(s) 50, 524, 611
Tsp45I GTSAC 3 cut(s) 50, 524, 611
TspDTI ATGAA 2 cut(s) 360, 594
TspGWI ACGGA 2 cut(s) 84, 216
TspRI CASTG 1 cut(s) 616
XbaI TCTAGA 1 cut(s) 553
XhoI CTCGAG 1 cut(s) 591
XmiI GTMKAC 1 cut(s) 387
XspI CTAG 3 cut(s) 288, 405, 554
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.