RchiOBHm_Chr2g0086251

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
1388192 .. 1388548
357 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46177

Sequence Viewer

Length: 180 bp
ATGCCAACACTTTGTAGAAGAGATGTCGAACCTGAAATTGTTGGTTTGAGTAGCAAAGATATTGAACAAAGCAACATAAGTGATGATGATTTTATCGATGATAATCCCCTACAAGAGGAATTACTATCAGGAGATGAAGATAACACTCGAGAAAGTGATGGATACAGTGACTTGGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

59

Amino Acids

6.65

Weight (kDa)

4.05

Isoelectric Point (pI)

78.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 115
AgsI TTSAA 1 cut(s) 65
Ama87I CYCGRG 1 cut(s) 147
AvaI CYCGRG 1 cut(s) 147
BccI CCATC 1 cut(s) 152
BciVI GTATCC 1 cut(s) 155
BfuI GTATCC 1 cut(s) 155
BmeT110I CYCGRG 1 cut(s) 147
Bsa29I ATCGAT 1 cut(s) 96
BsaBI GATNNNNATC 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 115
Bse8I GATNNNNATC 1 cut(s) 102
BseCI ATCGAT 1 cut(s) 96
BseJI GATNNNNATC 1 cut(s) 102
BseLI CCNNNNNNNGG 1 cut(s) 115
BshVI ATCGAT 1 cut(s) 96
BsiHKCI CYCGRG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 115
BsoBI CYCGRG 1 cut(s) 147
BspDI ATCGAT 1 cut(s) 96
Bst4CI ACNGT 1 cut(s) 167
Bst6I CTCTTC 1 cut(s) 13
BstENI CCTNNNNNAGG 1 cut(s) 113
Bsu15I ATCGAT 1 cut(s) 96
BsuI GTATCC 1 cut(s) 155
BsuTUI ATCGAT 1 cut(s) 96
BtsIMutI CAGTG 1 cut(s) 172
ClaI ATCGAT 1 cut(s) 96
Eam1104I CTCTTC 1 cut(s) 13
EarI CTCTTC 1 cut(s) 13
Eco88I CYCGRG 1 cut(s) 147
EcoNI CCTNNNNNAGG 1 cut(s) 113
FaiI YATR 1 cut(s) 77
Hpy188III TCNNGA 2 cut(s) 129, 149
HpyCH4III ACNGT 1 cut(s) 167
LpnPI CCDG 2 cut(s) 45, 114
MaeIII GTNAC 1 cut(s) 167
MboII GAAGA 2 cut(s) 30, 149
MluCI AATT 2 cut(s) 36, 119
MnlI CCTC 1 cut(s) 109
MseI TTAA 1 cut(s) 178
NmuCI GTSAC 1 cut(s) 167
PaeR7I CTCGAG 1 cut(s) 147
SaqAI TTAA 1 cut(s) 178
SetI ASST 1 cut(s) 34
Sfr274I CTCGAG 1 cut(s) 147
SgeI CNNG 5 cut(s) 44, 125, 141, 159, 161
SlaI CTCGAG 1 cut(s) 147
SmlI CTYRAG 1 cut(s) 147
SmoI CTYRAG 1 cut(s) 147
Sse9I AATT 2 cut(s) 36, 119
TaaI ACNGT 1 cut(s) 167
TaqI TCGA 3 cut(s) 27, 96, 148
TasI AATT 2 cut(s) 36, 119
Tru1I TTAA 1 cut(s) 178
Tru9I TTAA 1 cut(s) 178
TscAI CASTG 1 cut(s) 172
TseFI GTSAC 1 cut(s) 167
Tsp45I GTSAC 1 cut(s) 167
TspDTI ATGAA 1 cut(s) 150
TspRI CASTG 1 cut(s) 172
XagI CCTNNNNNAGG 1 cut(s) 113
XhoI CTCGAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.