RchiOBHm_Chr6g0246651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
2338521 .. 2341228
2708 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ22110

Sequence Viewer

Length: 150 bp
ATGAATAGAGATGTCGAACCTGAAATTGTTGGTTTGAGTAGCAAAGATATTGAACAAAGCAACATAAGTGACGATGATTTTATCGATGATAATCCTCTAGAGGAATTACTATCAGGAGATGAAGATAACACTCGAGAAAGTGATGGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.47

Weight (kDa)

4.05

Isoelectric Point (pI)

63.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 53
Ama87I CYCGRG 1 cut(s) 132
AvaI CYCGRG 1 cut(s) 132
BccI CCATC 1 cut(s) 137
BfaI CTAG 1 cut(s) 98
BmeT110I CYCGRG 1 cut(s) 132
Bsa29I ATCGAT 1 cut(s) 84
BsaBI GATNNNNATC 1 cut(s) 90
Bse8I GATNNNNATC 1 cut(s) 90
BseCI ATCGAT 1 cut(s) 84
BseJI GATNNNNATC 1 cut(s) 90
BshVI ATCGAT 1 cut(s) 84
BsiHKCI CYCGRG 1 cut(s) 132
BsoBI CYCGRG 1 cut(s) 132
BspDI ATCGAT 1 cut(s) 84
Bsu15I ATCGAT 1 cut(s) 84
BsuTUI ATCGAT 1 cut(s) 84
ClaI ATCGAT 1 cut(s) 84
Eco88I CYCGRG 1 cut(s) 132
FaiI YATR 1 cut(s) 65
FspBI CTAG 1 cut(s) 98
FspEI CC 6 cut(s) 15, 33, 86, 99, 108, 129
Hpy188III TCNNGA 3 cut(s) 98, 114, 134
LpnPI CCDG 2 cut(s) 33, 99
MaeI CTAG 1 cut(s) 98
MaeIII GTNAC 1 cut(s) 68
MboII GAAGA 1 cut(s) 134
MluCI AATT 2 cut(s) 24, 104
MnlI CCTC 2 cut(s) 94, 105
NmuCI GTSAC 1 cut(s) 68
PaeR7I CTCGAG 1 cut(s) 132
SetI ASST 1 cut(s) 22
Sfr274I CTCGAG 1 cut(s) 132
SgeI CNNG 5 cut(s) 32, 110, 126, 144, 146
SlaI CTCGAG 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 132
SmoI CTYRAG 1 cut(s) 132
Sse9I AATT 2 cut(s) 24, 104
SspMI CTAG 1 cut(s) 98
TaqI TCGA 3 cut(s) 15, 84, 133
TasI AATT 2 cut(s) 24, 104
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
TspDTI ATGAA 2 cut(s) 17, 135
XbaI TCTAGA 1 cut(s) 97
XhoI CTCGAG 1 cut(s) 132
XspI CTAG 1 cut(s) 98
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.