Rmu_sc0011626.1_g000001

TdcA1-ORF2 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011626.1
OG0001541
Physical Location & Seq
Reverse (-)
312 .. 986
675 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011626.1_g000001.1.cds

Sequence Viewer

Length: 675 bp
atgaaattcctcgcttttgctagtttcttttgtagtgatagtggtatatatgtccatggagtttttgttggtggaacacatgattattatggtgttttgctaaatattgtgagattaaggtacgtagatatgcatcacgtttttctattcaaatgcaagtggttcaacacagacgaaacaaagagagacgcgagaaaaagagtacaacgtgattataatcttatgagcattaattcaagctttgtctggtatgaggatgaaccttttatacttgctagtgaagcgcatcaagtgttttatttagatgattataagttgggccctgaatggaaagttgtccaaaaagtgcaaatgagacatgtatgggatgtcccagaggtagatgacgaggatgaagaggtagatgaggaaaattttgatcctgtggctaataatgatgtatatcagcaagatgaatacaatgaaattcaatggtcagttcaagaagagggtcttgaaaatcctcaattacatcaagaggatattgagcctgaagtcattgcttcaaatgtcgagagtgacgaatggatagatgatggtaggcttaatgatttcatctgtgatgatgttgaagaaaatgatactgattatgatgacaatgaagaaatcatttcaagtgatgatgatagtgattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21 Transposase_24

Protein Analysis

224

Amino Acids

26.54

Weight (kDa)

4.07

Isoelectric Point (pI)

44.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 216, 312
AccII CGCG 1 cut(s) 191
AclWI GGATC 1 cut(s) 413
AcsI RAATTY 3 cut(s) 5, 412, 465
AcuI CTGAAG 1 cut(s) 552
AfaI GTAC 2 cut(s) 122, 204
AflIII ACRYGT 1 cut(s) 358
AgsI TTSAA 9 cut(s) 151, 166, 237, 470, 482, 497, 546, 611, 654
AluBI AGCT 1 cut(s) 240
AluI AGCT 1 cut(s) 240
Alw26I GTCTC 2 cut(s) 180, 349
AlwI GGATC 1 cut(s) 413
AoxI GGCC 1 cut(s) 319
ApaI GGGCCC 1 cut(s) 323
ApoI RAATTY 3 cut(s) 5, 412, 465
AseI ATTAAT 1 cut(s) 231
AspLEI GCGC 1 cut(s) 286
AspS9I GGNCC 2 cut(s) 319, 320
BaeGI GKGCMC 1 cut(s) 323
BanII GRGCYC 1 cut(s) 323
BccI CCATC 1 cut(s) 569
BcoDI GTCTC 2 cut(s) 180, 349
BfaI CTAG 2 cut(s) 21, 276
BmgT120I GGNCC 2 cut(s) 319, 320
BmiI GGNNCC 1 cut(s) 321
BmsI GCATC 2 cut(s) 142, 295
BsaAI YACGTR 1 cut(s) 124
BsaBI GATNNNNATC 3 cut(s) 132, 216, 441
BsaJI CCNNGG 1 cut(s) 55
BsaXI ACNNNNNCTCC 2 cut(s) 51, 81
Bse3DI GCAATG 1 cut(s) 537
Bse8I GATNNNNATC 3 cut(s) 132, 216, 441
BseDI CCNNGG 1 cut(s) 55
BseGI GGATG 3 cut(s) 262, 373, 397
BseJI GATNNNNATC 3 cut(s) 132, 216, 441
BseMI GCAATG 1 cut(s) 537
BseSI GKGCMC 1 cut(s) 323
Bsh1236I CGCG 1 cut(s) 191
BshFI GGCC 1 cut(s) 321
BslFI GGGAC 1 cut(s) 356
BsmAI GTCTC 2 cut(s) 180, 349
BsmBI CGTCTC 1 cut(s) 180
BsmFI GGGAC 1 cut(s) 356
BsnI GGCC 1 cut(s) 321
Bsp120I GGGCCC 1 cut(s) 319
Bsp1286I GDGCHC 1 cut(s) 323
Bsp143I GATC 1 cut(s) 418
Bsp19I CCATGG 1 cut(s) 55
BspANI GGCC 1 cut(s) 321
BspFNI CGCG 1 cut(s) 191
BspLI GGNNCC 1 cut(s) 321
BspPI GGATC 1 cut(s) 413
BsrDI GCAATG 1 cut(s) 537
BssECI CCNNGG 1 cut(s) 55
BssMI GATC 1 cut(s) 418
BssT1I CCWWGG 1 cut(s) 55
Bst6I CTCTTC 2 cut(s) 390, 480
BstBAI YACGTR 1 cut(s) 124
BstDSI CCRYGG 1 cut(s) 55
BstF5I GGATG 3 cut(s) 262, 373, 397
BstFNI CGCG 1 cut(s) 191
BstHHI GCGC 1 cut(s) 286
BstKTI GATC 1 cut(s) 421
BstMAI GTCTC 2 cut(s) 180, 349
BstMBI GATC 1 cut(s) 418
BstMWI GCNNNNNNNGC 1 cut(s) 281
BstNSI RCATGY 1 cut(s) 362
BstSLI GKGCMC 1 cut(s) 323
BstSNI TACGTA 1 cut(s) 124
BstUI CGCG 1 cut(s) 191
BsuRI GGCC 1 cut(s) 321
BtgI CCRYGG 1 cut(s) 55
BtsCI GGATG 3 cut(s) 262, 373, 397
CfoI GCGC 1 cut(s) 286
Cfr13I GGNCC 2 cut(s) 319, 320
CseI GACGC 1 cut(s) 197
Csp6I GTAC 2 cut(s) 121, 203
CviAII CATG 3 cut(s) 56, 80, 359
CviJI RGCY 5 cut(s) 240, 321, 428, 529, 583
CviKI_1 RGCY 5 cut(s) 240, 321, 428, 529, 583
CviQI GTAC 2 cut(s) 121, 203
DpnI GATC 1 cut(s) 420
DpnII GATC 1 cut(s) 418
Eam1104I CTCTTC 2 cut(s) 390, 480
EarI CTCTTC 2 cut(s) 390, 480
Eco105I TACGTA 1 cut(s) 124
Eco130I CCWWGG 1 cut(s) 55
Eco24I GRGCYC 1 cut(s) 323
Eco57I CTGAAG 1 cut(s) 552
EcoO109I RGGNCCY 1 cut(s) 320
EcoT14I CCWWGG 1 cut(s) 55
EcoT22I ATGCAT 1 cut(s) 135
EcoT38I GRGCYC 1 cut(s) 323
ErhI CCWWGG 1 cut(s) 55
Esp3I CGTCTC 1 cut(s) 180
FaeI CATG 3 cut(s) 59, 83, 362
FalI AAGNNNNNCTT 2 cut(s) 477, 509
FaqI GGGAC 1 cut(s) 356
FatI CATG 3 cut(s) 55, 79, 358
FokI GGATG 3 cut(s) 269, 380, 404
FriOI GRGCYC 1 cut(s) 323
FspBI CTAG 2 cut(s) 21, 276
GlaI GCGC 1 cut(s) 285
HaeIII GGCC 1 cut(s) 321
HgaI GACGC 1 cut(s) 197
HhaI GCGC 1 cut(s) 286
Hin1II CATG 3 cut(s) 59, 83, 362
Hin6I GCGC 1 cut(s) 284
HinP1I GCGC 1 cut(s) 284
HindIII AAGCTT 1 cut(s) 238
Hpy188III TCNNGA 4 cut(s) 482, 494, 515, 553
HpyCH4IV ACGT 3 cut(s) 123, 138, 208
HpyCH4V TGCA 3 cut(s) 133, 156, 349
HpyF10VI GCNNNNNNNGC 1 cut(s) 281
HpySE526I ACGT 3 cut(s) 123, 138, 208
Hsp92II CATG 3 cut(s) 59, 83, 362
HspAI GCGC 1 cut(s) 284
Kzo9I GATC 1 cut(s) 418
LpnPI CCDG 5 cut(s) 232, 336, 387, 435, 543
LweI GCATC 2 cut(s) 142, 295
MaeI CTAG 2 cut(s) 21, 276
MaeII ACGT 3 cut(s) 123, 138, 208
MaeIII GTNAC 1 cut(s) 557
MalI GATC 1 cut(s) 420
MboI GATC 1 cut(s) 418
MboII GAAGA 4 cut(s) 407, 497, 623, 653
MhlI GDGCHC 1 cut(s) 323
MluCI AATT 5 cut(s) 5, 232, 412, 465, 506
MnlI CCTC 9 cut(s) 20, 247, 370, 382, 391, 400, 481, 511, 513
Mph1103I ATGCAT 1 cut(s) 135
MseI TTAA 3 cut(s) 116, 231, 585
MvnI CGCG 1 cut(s) 191
MwoI GCNNNNNNNGC 1 cut(s) 281
NcoI CCATGG 1 cut(s) 55
NdeII GATC 1 cut(s) 418
NlaIII CATG 3 cut(s) 59, 83, 362
NlaIV GGNNCC 1 cut(s) 321
NmuCI GTSAC 1 cut(s) 557
NsiI ATGCAT 1 cut(s) 135
NspI RCATGY 1 cut(s) 362
PciI ACATGT 1 cut(s) 358
PcsI WCGNNNNNNNCGW 1 cut(s) 558
Ppu21I YACGTR 1 cut(s) 124
PscI ACATGT 1 cut(s) 358
PshBI ATTAAT 1 cut(s) 231
PsiI TTATAA 2 cut(s) 216, 312
PspN4I GGNNCC 1 cut(s) 321
PspOMI GGGCCC 1 cut(s) 319
PspPI GGNCC 2 cut(s) 319, 320
PsrI GAACNNNNNNTAC 2 cut(s) 252, 284
RsaI GTAC 2 cut(s) 122, 204
RsaNI GTAC 2 cut(s) 121, 203
SaqAI TTAA 3 cut(s) 116, 231, 585
Sau3AI GATC 1 cut(s) 418
Sau96I GGNCC 2 cut(s) 319, 320
SduI GDGCHC 1 cut(s) 323
SetI ASST 8 cut(s) 122, 126, 141, 211, 242, 265, 381, 402
SfaNI GCATC 2 cut(s) 142, 295
SnaBI TACGTA 1 cut(s) 124
Sse9I AATT 5 cut(s) 5, 232, 412, 465, 506
SspI AATATT 1 cut(s) 106
SspMI CTAG 2 cut(s) 21, 276
StyI CCWWGG 1 cut(s) 55
TaiI ACGT 3 cut(s) 126, 141, 211
TaqI TCGA 1 cut(s) 552
TasI AATT 5 cut(s) 5, 232, 412, 465, 506
TatI WGTACW 1 cut(s) 202
Tru1I TTAA 3 cut(s) 116, 231, 585
Tru9I TTAA 3 cut(s) 116, 231, 585
TseFI GTSAC 1 cut(s) 557
Tsp45I GTSAC 1 cut(s) 557
TspDTI ATGAA 7 cut(s) 17, 273, 408, 468, 477, 583, 654
VspI ATTAAT 1 cut(s) 231
XapI RAATTY 3 cut(s) 5, 412, 465
XceI RCATGY 1 cut(s) 362
XspI CTAG 2 cut(s) 21, 276
Zsp2I ATGCAT 1 cut(s) 135
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.