Rh2CG188800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Forward (+)
17777881 .. 17781242
3362 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG188800.1

Sequence Viewer

Length: 423 bp
ATGGATGATGAATTTGTCTTTGATGGTGAGGATGATGGCGAGGATGACGACAATGCTTCAATGATGGACATGTTAAATGATGTTCAAGGGCCTTTACATATGGAGATAGATGATGAGACAAAGGTAGATGACGAGGATGAAGAGGTAGATGAGGAAAATTTTGATCCAGTCGTGGCTAATAATGATGTATATCAGCAAGATGAATTCAATGAAATTCAATGGTCAGTTCAAGAAGAGGGTCTTGAAAATCCTCAATTACATCAAGAGGATATTGAGCCTGAAGTCATTGCTTCAAATGTCGAGAGTGACGAATTGATAGATGATAGTAGGCTTAATGATTTCATCTGTGATGATGTTGAAGAAAACGATACTGATTATGATGACAATGAAGAAATCATTTCAAGTGATGACAATAGTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

16.15

Weight (kDa)

4.05

Isoelectric Point (pI)

48.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 158
AcsI RAATTY 4 cut(s) 11, 157, 203, 213
AcuI CTGAAG 1 cut(s) 300
AflIII ACRYGT 1 cut(s) 69
AgsI TTSAA 9 cut(s) 60, 86, 208, 218, 230, 245, 294, 359, 402
Alw26I GTCTC 1 cut(s) 110
AlwI GGATC 1 cut(s) 158
AoxI GGCC 1 cut(s) 89
ApoI RAATTY 4 cut(s) 11, 157, 203, 213
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 38
BccI CCATC 3 cut(s) 17, 29, 58
BcoDI GTCTC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 89
BsaBI GATNNNNATC 1 cut(s) 189
Bse1I ACTGG 1 cut(s) 167
Bse3DI GCAATG 1 cut(s) 285
Bse8I GATNNNNATC 1 cut(s) 189
BseGI GGATG 4 cut(s) 10, 37, 49, 142
BseJI GATNNNNATC 1 cut(s) 189
BseMI GCAATG 1 cut(s) 285
BseNI ACTGG 1 cut(s) 167
BshFI GGCC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 110
BsnI GGCC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 163
BspANI GGCC 1 cut(s) 91
BspPI GGATC 1 cut(s) 158
BsrDI GCAATG 1 cut(s) 285
BsrI ACTGG 1 cut(s) 167
BssMI GATC 1 cut(s) 163
Bst6I CTCTTC 2 cut(s) 135, 228
BstF5I GGATG 4 cut(s) 10, 37, 49, 142
BstKTI GATC 1 cut(s) 166
BstMAI GTCTC 1 cut(s) 110
BstMBI GATC 1 cut(s) 163
BstNSI RCATGY 1 cut(s) 73
BsuRI GGCC 1 cut(s) 91
BtsCI GGATG 4 cut(s) 10, 37, 49, 142
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 1 cut(s) 70
CviJI RGCY 4 cut(s) 91, 176, 277, 331
CviKI_1 RGCY 4 cut(s) 91, 176, 277, 331
DpnI GATC 1 cut(s) 165
DpnII GATC 1 cut(s) 163
Eam1104I CTCTTC 2 cut(s) 135, 228
EarI CTCTTC 2 cut(s) 135, 228
Eco57I CTGAAG 1 cut(s) 300
EcoO109I RGGNCCY 1 cut(s) 89
EcoRI GAATTC 1 cut(s) 203
FaeI CATG 1 cut(s) 73
FaiI YATR 5 cut(s) 71, 99, 101, 190, 378
FalI AAGNNNNNCTT 2 cut(s) 225, 257
FatI CATG 1 cut(s) 69
FauNDI CATATG 1 cut(s) 99
FokI GGATG 4 cut(s) 17, 44, 56, 149
HaeIII GGCC 1 cut(s) 91
Hin1II CATG 1 cut(s) 73
HphI GGTGA 1 cut(s) 38
Hpy188III TCNNGA 4 cut(s) 230, 242, 263, 301
Hsp92II CATG 1 cut(s) 73
Kzo9I GATC 1 cut(s) 163
LpnPI CCDG 2 cut(s) 180, 291
MaeIII GTNAC 1 cut(s) 305
MalI GATC 1 cut(s) 165
MboI GATC 1 cut(s) 163
MboII GAAGA 4 cut(s) 152, 245, 371, 401
MluCI AATT 6 cut(s) 11, 157, 203, 213, 254, 311
MnlI CCTC 8 cut(s) 22, 34, 127, 136, 145, 229, 259, 261
MseI TTAA 2 cut(s) 74, 333
NdeI CATATG 1 cut(s) 99
NdeII GATC 1 cut(s) 163
NlaIII CATG 1 cut(s) 73
NmuCI GTSAC 1 cut(s) 305
NspI RCATGY 1 cut(s) 73
PciI ACATGT 1 cut(s) 69
PcsI WCGNNNNNNNCGW 1 cut(s) 306
PscI ACATGT 1 cut(s) 69
PspPI GGNCC 1 cut(s) 89
SaqAI TTAA 2 cut(s) 74, 333
Sau3AI GATC 1 cut(s) 163
Sau96I GGNCC 1 cut(s) 89
SetI ASST 2 cut(s) 126, 147
Sse9I AATT 6 cut(s) 11, 157, 203, 213, 254, 311
TaqI TCGA 1 cut(s) 300
TasI AATT 6 cut(s) 11, 157, 203, 213, 254, 311
Tru1I TTAA 2 cut(s) 74, 333
Tru9I TTAA 2 cut(s) 74, 333
TseFI GTSAC 1 cut(s) 305
Tsp45I GTSAC 1 cut(s) 305
TspDTI ATGAA 6 cut(s) 24, 153, 216, 225, 331, 402
XapI RAATTY 4 cut(s) 11, 157, 203, 213
XceI RCATGY 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.