Rh3CG094200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
7475851 .. 7476648
798 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG094200.1

Sequence Viewer

Length: 372 bp
ATGAGTCACTTAGTCCAAAGTGGATTGGTGGATGCAACTGATCAACTTTATTGTTTGGCTTGTAAACCCGATGTAGATGACGAGGATGAAGAGGTAGATGAGGAAAATTTTGATCCAGTCGTGGCTAATAATGATGTATATCAGCAAGATGAATTCAATGAAATTCAATGGTCAGTTCAAGAAGAGGGTCTTGAAAATCCTCAATTACATCAAGAGGATATTGAGCCCGAAGTCATTGCTTCAAATGTCGAGAGTGACGAATTGATAGATGATGGTAGGCTTAATGATTTCATCTGTGATGATGTTGAAGAAAACGATACTGATTATGATGACAATGAAGAAATCATTTCAAGTGATGACAATAGTGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

123

Amino Acids

14.05

Weight (kDa)

4.05

Isoelectric Point (pI)

56.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 107
AcsI RAATTY 3 cut(s) 106, 152, 162
AgsI TTSAA 7 cut(s) 157, 167, 179, 194, 243, 308, 351
AlwI GGATC 1 cut(s) 107
ApoI RAATTY 3 cut(s) 106, 152, 162
BanII GRGCYC 1 cut(s) 228
BccI CCATC 1 cut(s) 266
BcgI CGANNNNNNTGC 2 cut(s) 218, 252
BclI TGATCA 1 cut(s) 40
BmsI GCATC 1 cut(s) 22
BsaBI GATNNNNATC 1 cut(s) 138
Bse1I ACTGG 1 cut(s) 116
Bse3DI GCAATG 1 cut(s) 234
Bse8I GATNNNNATC 1 cut(s) 138
BseGI GGATG 2 cut(s) 37, 91
BseJI GATNNNNATC 1 cut(s) 138
BseMI GCAATG 1 cut(s) 234
BseNI ACTGG 1 cut(s) 116
Bsp1286I GDGCHC 1 cut(s) 228
Bsp143I GATC 2 cut(s) 40, 112
BspPI GGATC 1 cut(s) 107
BsrDI GCAATG 1 cut(s) 234
BsrI ACTGG 1 cut(s) 116
BssMI GATC 2 cut(s) 40, 112
Bst6I CTCTTC 2 cut(s) 84, 177
BstDEI CTNAG 1 cut(s) 10
BstF5I GGATG 2 cut(s) 37, 91
BstKTI GATC 2 cut(s) 43, 115
BstMBI GATC 2 cut(s) 40, 112
BtsCI GGATG 2 cut(s) 37, 91
CviJI RGCY 4 cut(s) 59, 125, 226, 280
CviKI_1 RGCY 4 cut(s) 59, 125, 226, 280
DdeI CTNAG 1 cut(s) 10
DpnI GATC 2 cut(s) 42, 114
DpnII GATC 2 cut(s) 40, 112
Eam1104I CTCTTC 2 cut(s) 84, 177
EarI CTCTTC 2 cut(s) 84, 177
Eco24I GRGCYC 1 cut(s) 228
EcoRI GAATTC 1 cut(s) 152
EcoT38I GRGCYC 1 cut(s) 228
FaiI YATR 2 cut(s) 139, 327
FalI AAGNNNNNCTT 2 cut(s) 174, 206
FbaI TGATCA 1 cut(s) 40
FokI GGATG 2 cut(s) 44, 98
FriOI GRGCYC 1 cut(s) 228
HinfI GANTC 1 cut(s) 4
Hpy166II GTNNAC 1 cut(s) 65
Hpy188III TCNNGA 4 cut(s) 179, 191, 212, 250
Hpy8I GTNNAC 1 cut(s) 65
HpyCH4V TGCA 1 cut(s) 35
HpyF3I CTNAG 1 cut(s) 10
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 2 cut(s) 40, 112
LpnPI CCDG 1 cut(s) 129
LweI GCATC 1 cut(s) 22
MaeIII GTNAC 2 cut(s) 5, 254
MalI GATC 2 cut(s) 42, 114
MboI GATC 2 cut(s) 40, 112
MboII GAAGA 4 cut(s) 101, 194, 320, 350
MhlI GDGCHC 1 cut(s) 228
MluCI AATT 5 cut(s) 106, 152, 162, 203, 260
MlyI GAGTC 1 cut(s) 13
MnlI CCTC 6 cut(s) 76, 85, 94, 178, 208, 210
MseI TTAA 1 cut(s) 282
NdeII GATC 2 cut(s) 40, 112
NmuCI GTSAC 2 cut(s) 5, 254
PcsI WCGNNNNNNNCGW 1 cut(s) 255
PleI GAGTC 1 cut(s) 12
PpsI GAGTC 1 cut(s) 12
SaqAI TTAA 1 cut(s) 282
Sau3AI GATC 2 cut(s) 40, 112
SchI GAGTC 1 cut(s) 13
SduI GDGCHC 1 cut(s) 228
SetI ASST 1 cut(s) 96
SfaNI GCATC 1 cut(s) 22
Sse9I AATT 5 cut(s) 106, 152, 162, 203, 260
TaqI TCGA 1 cut(s) 249
TasI AATT 5 cut(s) 106, 152, 162, 203, 260
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TseFI GTSAC 2 cut(s) 5, 254
Tsp45I GTSAC 2 cut(s) 5, 254
TspDTI ATGAA 5 cut(s) 102, 165, 174, 280, 351
XapI RAATTY 3 cut(s) 106, 152, 162
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.