Rmu_sc0003158.1_g000010

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003158.1
Physical Location & Seq
Reverse (-)
47277 .. 47894
618 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003158.1_g000010.1.cds

Sequence Viewer

Length: 618 bp
atggggtcacatgaaggagaagcctgtacttacaatggcaagttgctcagtgttgttaaagtccaatttcaattaggctttaaggttattcttttcaattgtgagtggtataatacagggaacaagaacaatagagtgaagaaagattatcatctcttgtcagttaatataaatagtcgatggtacaagaacgatccatatgtgctagcaattgaagcagatcaagtcttttatctcgatgacccaaagttgggtcatccatggaaagttgttcaaaggattcaacctagacatgtgtgggatgtgccagagaaagaagataatgaagatgacaataacattgacaacaatggtgatgagaatactgatgatgatagtgacactaacatggaatgggaagtccagatggaggatgatgaaattgaaacatcgttagttagagatgatggtgagcctgaaactataatcttagatgattccaataggtcattgctaattgacacagagaatgacaatgatttcataaatgatgatgctgacgttatggaggatgatgaactatcatcaaatgaaaatgaagatatagttggtagtgaggcagatagtgatttagaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

205

Amino Acids

23.7

Weight (kDa)

4.05

Isoelectric Point (pI)

35.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 188
AfaI GTAC 2 cut(s) 28, 185
AfiI CCNNNNNNNGG 3 cut(s) 250, 251, 409
AflIII ACRYGT 1 cut(s) 292
AgsI TTSAA 6 cut(s) 71, 97, 215, 275, 284, 425
AjuI GAANNNNNNNTTGG 2 cut(s) 570, 602
AlwI GGATC 1 cut(s) 188
AsuHPI GGTGA 2 cut(s) 365, 461
AsuNHI GCTAGC 1 cut(s) 205
BccI CCATC 3 cut(s) 174, 400, 440
BfaI CTAG 2 cut(s) 206, 288
BmsI GCATC 1 cut(s) 523
BmtI GCTAGC 1 cut(s) 209
BsaBI GATNNNNATC 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 260
Bsc4I CCNNNNNNNGG 3 cut(s) 250, 251, 409
Bse3DI GCAATG 1 cut(s) 488
Bse8I GATNNNNATC 1 cut(s) 150
BseDI CCNNGG 1 cut(s) 260
BseGI GGATG 4 cut(s) 256, 307, 418, 556
BseJI GATNNNNATC 1 cut(s) 150
BseLI CCNNNNNNNGG 3 cut(s) 250, 251, 409
BseMI GCAATG 1 cut(s) 488
BseMII CTCAG 1 cut(s) 61
BslI CCNNNNNNNGG 3 cut(s) 250, 251, 409
Bsp143I GATC 2 cut(s) 193, 220
Bsp19I CCATGG 1 cut(s) 260
BspCNI CTCAG 1 cut(s) 60
BspOI GCTAGC 1 cut(s) 209
BspPI GGATC 1 cut(s) 188
BsrDI GCAATG 1 cut(s) 488
BssECI CCNNGG 1 cut(s) 260
BssMI GATC 2 cut(s) 193, 220
BssT1I CCWWGG 1 cut(s) 260
BstC8I GCNNGC 1 cut(s) 207
BstDEI CTNAG 2 cut(s) 47, 469
BstDSI CCRYGG 1 cut(s) 260
BstF5I GGATG 4 cut(s) 256, 307, 418, 556
BstKTI GATC 2 cut(s) 196, 223
BstMBI GATC 2 cut(s) 193, 220
BstMWI GCNNNNNNNGC 1 cut(s) 215
BstNSI RCATGY 1 cut(s) 296
BtgI CCRYGG 1 cut(s) 260
BtsCI GGATG 4 cut(s) 256, 307, 418, 556
BtsIMutI CAGTG 1 cut(s) 55
Cac8I GCNNGC 1 cut(s) 207
Csp6I GTAC 2 cut(s) 27, 184
CviAII CATG 4 cut(s) 11, 261, 293, 388
CviJI RGCY 3 cut(s) 23, 78, 454
CviKI_1 RGCY 3 cut(s) 23, 78, 454
CviQI GTAC 2 cut(s) 27, 184
DdeI CTNAG 2 cut(s) 47, 469
DpnI GATC 2 cut(s) 195, 222
DpnII GATC 2 cut(s) 193, 220
Eco130I CCWWGG 1 cut(s) 260
EcoT14I CCWWGG 1 cut(s) 260
ErhI CCWWGG 1 cut(s) 260
FaeI CATG 4 cut(s) 14, 264, 296, 391
FatI CATG 4 cut(s) 10, 260, 292, 387
FauNDI CATATG 1 cut(s) 199
FokI GGATG 4 cut(s) 243, 314, 425, 563
FspBI CTAG 2 cut(s) 206, 288
Hin1II CATG 4 cut(s) 14, 264, 296, 391
HinfI GANTC 2 cut(s) 280, 476
HphI GGTGA 2 cut(s) 365, 461
Hpy188III TCNNGA 2 cut(s) 236, 403
HpyAV CCTTC 1 cut(s) 8
HpyCH4IV ACGT 1 cut(s) 540
HpyF10VI GCNNNNNNNGC 1 cut(s) 215
HpyF3I CTNAG 2 cut(s) 47, 469
HpySE526I ACGT 1 cut(s) 540
Hsp92II CATG 4 cut(s) 14, 264, 296, 391
Kzo9I GATC 2 cut(s) 193, 220
LpnPI CCDG 5 cut(s) 37, 102, 321, 416, 468
LweI GCATC 1 cut(s) 523
MaeI CTAG 2 cut(s) 206, 288
MaeII ACGT 1 cut(s) 540
MaeIII GTNAC 2 cut(s) 6, 377
MalI GATC 2 cut(s) 195, 222
MboI GATC 2 cut(s) 193, 220
MboII GAAGA 4 cut(s) 151, 329, 338, 590
MfeI CAATTG 2 cut(s) 97, 210
MluCI AATT 6 cut(s) 65, 71, 97, 210, 420, 495
MnlI CCTC 3 cut(s) 403, 541, 589
MseI TTAA 3 cut(s) 57, 81, 165
MslI CAYNNNNRTG 1 cut(s) 386
MunI CAATTG 2 cut(s) 97, 210
MwoI GCNNNNNNNGC 1 cut(s) 215
NcoI CCATGG 1 cut(s) 260
NdeI CATATG 1 cut(s) 199
NdeII GATC 2 cut(s) 193, 220
NheI GCTAGC 1 cut(s) 205
NlaIII CATG 4 cut(s) 14, 264, 296, 391
NmuCI GTSAC 2 cut(s) 6, 377
NspI RCATGY 1 cut(s) 296
PciI ACATGT 1 cut(s) 292
PfeI GAWTC 2 cut(s) 280, 476
PscI ACATGT 1 cut(s) 292
RsaI GTAC 2 cut(s) 28, 185
RsaNI GTAC 2 cut(s) 27, 184
RseI CAYNNNNRTG 1 cut(s) 386
SaqAI TTAA 3 cut(s) 57, 81, 165
Sau3AI GATC 2 cut(s) 193, 220
SetI ASST 4 cut(s) 87, 289, 488, 543
SfaNI GCATC 1 cut(s) 523
SmiMI CAYNNNNRTG 1 cut(s) 386
Sse9I AATT 6 cut(s) 65, 71, 97, 210, 420, 495
SspMI CTAG 2 cut(s) 206, 288
StyI CCWWGG 1 cut(s) 260
TaiI ACGT 1 cut(s) 543
TaqI TCGA 2 cut(s) 178, 237
TasI AATT 6 cut(s) 65, 71, 97, 210, 420, 495
TatI WGTACW 1 cut(s) 26
TfiI GAWTC 2 cut(s) 280, 476
Tru1I TTAA 3 cut(s) 57, 81, 165
Tru9I TTAA 3 cut(s) 57, 81, 165
TscAI CASTG 1 cut(s) 55
TseFI GTSAC 2 cut(s) 6, 377
Tsp45I GTSAC 2 cut(s) 6, 377
TspDTI ATGAA 7 cut(s) 27, 339, 432, 511, 570, 585, 591
TspRI CASTG 1 cut(s) 55
XceI RCATGY 1 cut(s) 296
XspI CTAG 2 cut(s) 206, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.