Rmu_co8127980.1_g000001

TdcA1-ORF2 protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8127980.1
Physical Location & Seq
Reverse (-)
170 .. 610
441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8127980.1_g000001.1.cds

Sequence Viewer

Length: 441 bp
atggagagatctcacaccacacaagatagtgcggttgtgactcttagttcacacggtgatgaactcttcaacttttatggaagtttgaccagtgttgttcaactaaagtttcaaggtggctacaatgtgtttctatttcaatgtcattggtataacacatcagacaaaaagagaaaggtggactatcatctcatgtctgttaatgtgaatactcgatggtataataatgatccttatgtgtatgcaacacaagtagataaagttttctatcttgatgacacaaagttgggtcatccttggaaagttgtgcagaaaattcagtatagacatgtttgggatgtccttgagatagaagatgatgataataaagcaccatcagaagaagaggaaaacaatgaagagtctgatgaagaggttgatgagattaatctggaagtttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

146

Amino Acids

17.28

Weight (kDa)

4.58

Isoelectric Point (pI)

43.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 32
AclWI GGATC 1 cut(s) 224
AcsI RAATTY 1 cut(s) 315
AdeI CACNNNGTG 1 cut(s) 56
AflIII ACRYGT 1 cut(s) 328
AgsI TTSAA 4 cut(s) 70, 101, 113, 140
AlwI GGATC 1 cut(s) 224
ApoI RAATTY 1 cut(s) 315
AseI ATTAAT 1 cut(s) 426
AsuHPI GGTGA 1 cut(s) 68
BccI CCATC 2 cut(s) 210, 382
BglII AGATCT 1 cut(s) 8
BpuEI CTTGAG 1 cut(s) 365
BsaJI CCNNGG 1 cut(s) 296
Bse1I ACTGG 1 cut(s) 90
BseDI CCNNGG 1 cut(s) 296
BseGI GGATG 2 cut(s) 292, 343
BseNI ACTGG 1 cut(s) 90
BsgI GTGCAG 1 cut(s) 329
Bsp143I GATC 2 cut(s) 8, 229
BspACI CCGC 1 cut(s) 32
BspPI GGATC 1 cut(s) 224
BsrI ACTGG 1 cut(s) 90
BssECI CCNNGG 1 cut(s) 296
BssMI GATC 2 cut(s) 8, 229
BssT1I CCWWGG 1 cut(s) 296
Bst4CI ACNGT 1 cut(s) 56
Bst6I CTCTTC 4 cut(s) 71, 378, 393, 405
BstDEI CTNAG 1 cut(s) 44
BstF5I GGATG 2 cut(s) 292, 343
BstKTI GATC 2 cut(s) 11, 232
BstMBI GATC 2 cut(s) 8, 229
BstNSI RCATGY 1 cut(s) 332
BstX2I RGATCY 1 cut(s) 8
BstYI RGATCY 1 cut(s) 8
BtsCI GGATG 2 cut(s) 292, 343
BtsIMutI CAGTG 1 cut(s) 97
CviAII CATG 2 cut(s) 193, 329
CviJI RGCY 1 cut(s) 120
CviKI_1 RGCY 1 cut(s) 120
DdeI CTNAG 1 cut(s) 44
DpnI GATC 2 cut(s) 10, 231
DpnII GATC 2 cut(s) 8, 229
DraIII CACNNNGTG 1 cut(s) 56
Eam1104I CTCTTC 4 cut(s) 71, 378, 393, 405
EarI CTCTTC 4 cut(s) 71, 378, 393, 405
Eco130I CCWWGG 1 cut(s) 296
EcoT14I CCWWGG 1 cut(s) 296
ErhI CCWWGG 1 cut(s) 296
FaeI CATG 2 cut(s) 196, 332
FaiI YATR 8 cut(s) 78, 153, 194, 222, 237, 243, 324, 330
FatI CATG 2 cut(s) 192, 328
FokI GGATG 2 cut(s) 279, 350
Hin1II CATG 2 cut(s) 196, 332
HinfI GANTC 2 cut(s) 40, 401
HphI GGTGA 1 cut(s) 68
Hpy166II GTNNAC 2 cut(s) 50, 181
Hpy188I TCNGA 3 cut(s) 163, 379, 406
Hpy188III TCNNGA 2 cut(s) 272, 431
Hpy8I GTNNAC 2 cut(s) 50, 181
HpyCH4III ACNGT 1 cut(s) 56
HpyCH4V TGCA 2 cut(s) 245, 310
HpyF3I CTNAG 1 cut(s) 44
Hsp92II CATG 2 cut(s) 196, 332
Kzo9I GATC 2 cut(s) 8, 229
LpnPI CCDG 2 cut(s) 103, 416
MaeIII GTNAC 1 cut(s) 37
MalI GATC 2 cut(s) 10, 231
MboI GATC 2 cut(s) 8, 229
MboII GAAGA 6 cut(s) 58, 365, 392, 395, 410, 422
MflI RGATCY 1 cut(s) 8
MluCI AATT 1 cut(s) 315
MlyI GAGTC 2 cut(s) 34, 410
MnlI CCTC 2 cut(s) 379, 406
MseI TTAA 2 cut(s) 201, 426
MslI CAYNNNNRTG 1 cut(s) 57
NdeII GATC 2 cut(s) 8, 229
NlaIII CATG 2 cut(s) 196, 332
NmuCI GTSAC 1 cut(s) 37
NspI RCATGY 1 cut(s) 332
PciI ACATGT 1 cut(s) 328
PleI GAGTC 2 cut(s) 34, 409
PpsI GAGTC 2 cut(s) 34, 409
PscI ACATGT 1 cut(s) 328
PshBI ATTAAT 1 cut(s) 426
PsuI RGATCY 1 cut(s) 8
RseI CAYNNNNRTG 1 cut(s) 57
SaqAI TTAA 2 cut(s) 201, 426
Sau3AI GATC 2 cut(s) 8, 229
SchI GAGTC 2 cut(s) 34, 410
SetI ASST 3 cut(s) 118, 180, 417
SmiMI CAYNNNNRTG 1 cut(s) 57
SmlI CTYRAG 1 cut(s) 344
SmoI CTYRAG 1 cut(s) 344
Sse9I AATT 1 cut(s) 315
SsiI CCGC 1 cut(s) 32
StyI CCWWGG 1 cut(s) 296
TaaI ACNGT 1 cut(s) 56
TaqI TCGA 1 cut(s) 214
TasI AATT 1 cut(s) 315
Tru1I TTAA 2 cut(s) 201, 426
Tru9I TTAA 2 cut(s) 201, 426
TscAI CASTG 1 cut(s) 97
TseFI GTSAC 1 cut(s) 37
Tsp45I GTSAC 1 cut(s) 37
TspDTI ATGAA 3 cut(s) 75, 411, 423
TspRI CASTG 1 cut(s) 97
VspI ATTAAT 1 cut(s) 426
XapI RAATTY 1 cut(s) 315
XceI RCATGY 1 cut(s) 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.