Rmu_sc0004413.1_g000035

TdcA1-ORF2 protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004413.1
OG0001541
Physical Location & Seq
Forward (+)
163347 .. 166777
3431 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004413.1_g000035.1.cds

Sequence Viewer

Length: 735 bp
atgcatttagccaaaggtggtaagttagagatgttagagacatatgagatatggcataaacatggtgagaaattagatgctccgcctcctccaattgttcaagatgatcttgaacctaatgttgtcattcaaaatattttgaatgatgccttcccaattgttcaaggggttgaagatgttgacatgaataaggatgtaaaattagcagatgatgcattgggtgagatggcagatgctatggggaatcagaggttaggagacttaaaacgttatgtacgtaatcgagcccgtcccgaaggttcaattgcagagggatacattgtggaggaatcttgtgctttatatcttgacaacgttgagactgtgttttctcgacctgaaagaaactatgatggagatgaatcgggttctggatggaaagttattgaaaaaattcgacatagacatgtttgggatgttccagaaaatggagagactcatgccatggaaactaactacgttgatgaggaagaccaagaagaagttggagattttgttaggcttattgaagatctgaatgtgaatccaagtagaacattacgtagagataatgtagaacctgaaattcatgtgcttagtcacaaggatttagaacgtagtagttctgttgatgtcgatttcattgatgatgatccccaagatgatgaaattttgtccgcggatgaggaatacaccgagaataatgatgatgattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc Transposase_21 Transposase_24

Protein Analysis

244

Amino Acids

27.87

Weight (kDa)

4.29

Isoelectric Point (pI)

53.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 467
AccII CGCG 1 cut(s) 698
AciI CCGC 3 cut(s) 83, 696, 698
AclI AACGTT 2 cut(s) 268, 354
AclWI GGATC 1 cut(s) 665
AcsI RAATTY 3 cut(s) 432, 603, 687
AfaI GTAC 1 cut(s) 276
AfiI CCNNNNNNNGG 1 cut(s) 467
AflIII ACRYGT 1 cut(s) 445
AgsI TTSAA 9 cut(s) 101, 113, 131, 142, 164, 173, 303, 428, 548
Alw26I GTCTC 4 cut(s) 32, 252, 353, 467
AlwI GGATC 1 cut(s) 665
ApoI RAATTY 3 cut(s) 432, 603, 687
Asp700I GAANNNNTTC 1 cut(s) 432
AsuHPI GGTGA 2 cut(s) 77, 233
BanII GRGCYC 1 cut(s) 289
BbsI GAAGAC 1 cut(s) 516
BccI CCATC 3 cut(s) 220, 386, 408
BciVI GTATCC 1 cut(s) 308
BcoDI GTCTC 4 cut(s) 32, 252, 353, 467
BfuI GTATCC 1 cut(s) 308
BglII AGATCT 1 cut(s) 550
BmsI GCATC 4 cut(s) 67, 136, 202, 223
BpiI GAAGAC 1 cut(s) 516
BsaAI YACGTR 2 cut(s) 278, 581
BsaBI GATNNNNATC 1 cut(s) 669
BsaJI CCNNGG 2 cut(s) 483, 696
BsaXI ACNNNNNCTCC 2 cut(s) 519, 549
Bsc4I CCNNNNNNNGG 1 cut(s) 467
Bse8I GATNNNNATC 1 cut(s) 669
BseDI CCNNGG 2 cut(s) 483, 696
BseGI GGATG 4 cut(s) 199, 419, 460, 706
BseJI GATNNNNATC 1 cut(s) 669
BseLI CCNNNNNNNGG 1 cut(s) 467
BseRI GAGGAG 1 cut(s) 78
Bsh1236I CGCG 1 cut(s) 698
BslFI GGGAC 1 cut(s) 276
BslI CCNNNNNNNGG 1 cut(s) 467
BsmAI GTCTC 4 cut(s) 32, 252, 353, 467
BsmFI GGGAC 1 cut(s) 276
Bsp1286I GDGCHC 1 cut(s) 289
Bsp143I GATC 3 cut(s) 106, 550, 670
Bsp19I CCATGG 1 cut(s) 483
BspACI CCGC 3 cut(s) 83, 696, 698
BspFNI CGCG 1 cut(s) 698
BspPI GGATC 1 cut(s) 665
BssECI CCNNGG 2 cut(s) 483, 696
BssMI GATC 3 cut(s) 106, 550, 670
BssT1I CCWWGG 1 cut(s) 483
Bst4CI ACNGT 1 cut(s) 364
BstAPI GCANNNNNTGC 1 cut(s) 212
BstBAI YACGTR 2 cut(s) 278, 581
BstDEI CTNAG 1 cut(s) 614
BstDSI CCRYGG 2 cut(s) 483, 696
BstF5I GGATG 4 cut(s) 199, 419, 460, 706
BstFNI CGCG 1 cut(s) 698
BstKTI GATC 3 cut(s) 109, 553, 673
BstMAI GTCTC 4 cut(s) 32, 252, 353, 467
BstMBI GATC 3 cut(s) 106, 550, 670
BstMWI GCNNNNNNNGC 1 cut(s) 212
BstNSI RCATGY 1 cut(s) 449
BstSNI TACGTA 2 cut(s) 278, 581
BstUI CGCG 1 cut(s) 698
BstV2I GAAGAC 1 cut(s) 516
BstX2I RGATCY 1 cut(s) 550
BstYI RGATCY 1 cut(s) 550
BsuI GTATCC 1 cut(s) 308
BtgI CCRYGG 2 cut(s) 483, 696
BtsCI GGATG 4 cut(s) 199, 419, 460, 706
Cfr42I CCGCGG 1 cut(s) 699
Csp6I GTAC 1 cut(s) 275
CviAII CATG 6 cut(s) 62, 184, 446, 479, 484, 608
CviJI RGCY 3 cut(s) 11, 287, 541
CviKI_1 RGCY 3 cut(s) 11, 287, 541
CviQI GTAC 1 cut(s) 275
DdeI CTNAG 1 cut(s) 614
DpnI GATC 3 cut(s) 108, 552, 672
DpnII GATC 3 cut(s) 106, 550, 670
EciI GGCGGA 1 cut(s) 72
Eco105I TACGTA 2 cut(s) 278, 581
Eco130I CCWWGG 1 cut(s) 483
Eco24I GRGCYC 1 cut(s) 289
EcoT14I CCWWGG 1 cut(s) 483
EcoT22I ATGCAT 2 cut(s) 6, 217
EcoT38I GRGCYC 1 cut(s) 289
ErhI CCWWGG 1 cut(s) 483
FaeI CATG 6 cut(s) 65, 187, 449, 482, 487, 611
FalI AAGNNNNNCTT 2 cut(s) 93, 125
FaqI GGGAC 1 cut(s) 276
FatI CATG 6 cut(s) 61, 183, 445, 478, 483, 607
FauNDI CATATG 1 cut(s) 43
FokI GGATG 4 cut(s) 206, 426, 467, 713
FriOI GRGCYC 1 cut(s) 289
Hin1II CATG 6 cut(s) 65, 187, 449, 482, 487, 611
HincII GTYRAC 1 cut(s) 181
HindII GTYRAC 1 cut(s) 181
HinfI GANTC 5 cut(s) 244, 329, 401, 475, 562
HphI GGTGA 2 cut(s) 77, 233
Hpy166II GTNNAC 1 cut(s) 181
Hpy188I TCNGA 2 cut(s) 249, 555
Hpy188III TCNNGA 7 cut(s) 101, 110, 293, 347, 372, 411, 461
Hpy8I GTNNAC 1 cut(s) 181
HpyAV CCTTC 2 cut(s) 160, 290
HpyCH4III ACNGT 1 cut(s) 364
HpyCH4IV ACGT 6 cut(s) 268, 277, 354, 498, 580, 634
HpyCH4V TGCA 3 cut(s) 4, 215, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 212
HpyF3I CTNAG 1 cut(s) 614
HpySE526I ACGT 6 cut(s) 268, 277, 354, 498, 580, 634
Hsp92II CATG 6 cut(s) 65, 187, 449, 482, 487, 611
KspI CCGCGG 1 cut(s) 699
Kzo9I GATC 3 cut(s) 106, 550, 670
LmnI GCTCC 1 cut(s) 85
LpnPI CCDG 4 cut(s) 390, 396, 474, 612
LweI GCATC 4 cut(s) 67, 136, 202, 223
MaeII ACGT 6 cut(s) 268, 277, 354, 498, 580, 634
MaeIII GTNAC 1 cut(s) 617
MalI GATC 3 cut(s) 108, 552, 672
MboI GATC 3 cut(s) 106, 550, 670
MboII GAAGA 4 cut(s) 185, 521, 530, 560
MfeI CAATTG 3 cut(s) 93, 156, 303
MflI RGATCY 1 cut(s) 550
MhlI GDGCHC 1 cut(s) 289
MluCI AATT 8 cut(s) 71, 93, 156, 200, 303, 432, 603, 687
MlyI GAGTC 1 cut(s) 469
MmeI TCCRAC 1 cut(s) 505
MnlI CCTC 7 cut(s) 96, 99, 243, 304, 319, 499, 697
Mph1103I ATGCAT 2 cut(s) 6, 217
MroXI GAANNNNTTC 1 cut(s) 432
MseI TTAA 2 cut(s) 263, 733
MslI CAYNNNNRTG 2 cut(s) 60, 444
MspA1I CMGCKG 1 cut(s) 698
MunI CAATTG 3 cut(s) 93, 156, 303
MvnI CGCG 1 cut(s) 698
MwoI GCNNNNNNNGC 1 cut(s) 212
NcoI CCATGG 1 cut(s) 483
NdeI CATATG 1 cut(s) 43
NdeII GATC 3 cut(s) 106, 550, 670
NlaIII CATG 6 cut(s) 65, 187, 449, 482, 487, 611
NmuCI GTSAC 1 cut(s) 617
NsiI ATGCAT 2 cut(s) 6, 217
NspI RCATGY 1 cut(s) 449
PciI ACATGT 1 cut(s) 445
PcsI WCGNNNNNNNCGW 1 cut(s) 274
PdmI GAANNNNTTC 1 cut(s) 432
PfeI GAWTC 4 cut(s) 244, 329, 401, 562
PflMI CCANNNNNTGG 1 cut(s) 467
PleI GAGTC 1 cut(s) 469
PpsI GAGTC 1 cut(s) 469
Ppu21I YACGTR 2 cut(s) 278, 581
PscI ACATGT 1 cut(s) 445
Psp1406I AACGTT 2 cut(s) 268, 354
PsuI RGATCY 1 cut(s) 550
RsaI GTAC 1 cut(s) 276
RsaNI GTAC 1 cut(s) 275
RseI CAYNNNNRTG 2 cut(s) 60, 444
SacII CCGCGG 1 cut(s) 699
SaqAI TTAA 2 cut(s) 263, 733
Sau3AI GATC 3 cut(s) 106, 550, 670
SchI GAGTC 1 cut(s) 469
SduI GDGCHC 1 cut(s) 289
SfaNI GCATC 4 cut(s) 67, 136, 202, 223
Sfr303I CCGCGG 1 cut(s) 699
SgrBI CCGCGG 1 cut(s) 699
SmiMI CAYNNNNRTG 2 cut(s) 60, 444
SnaBI TACGTA 2 cut(s) 278, 581
Sse9I AATT 8 cut(s) 71, 93, 156, 200, 303, 432, 603, 687
SsiI CCGC 3 cut(s) 83, 696, 698
SspI AATATT 1 cut(s) 136
StyI CCWWGG 1 cut(s) 483
TaaI ACNGT 1 cut(s) 364
TaiI ACGT 6 cut(s) 271, 280, 357, 501, 583, 637
TaqI TCGA 4 cut(s) 283, 373, 436, 654
TasI AATT 8 cut(s) 71, 93, 156, 200, 303, 432, 603, 687
TfiI GAWTC 4 cut(s) 244, 329, 401, 562
Tru1I TTAA 2 cut(s) 263, 733
Tru9I TTAA 2 cut(s) 263, 733
TseFI GTSAC 1 cut(s) 617
Tsp45I GTSAC 1 cut(s) 617
TspDTI ATGAA 5 cut(s) 200, 414, 596, 649, 699
Van91I CCANNNNNTGG 1 cut(s) 467
XapI RAATTY 3 cut(s) 432, 603, 687
XceI RCATGY 1 cut(s) 449
XcmI CCANNNNNNNNNTGG 1 cut(s) 521
XmnI GAANNNNTTC 1 cut(s) 432
Zsp2I ATGCAT 2 cut(s) 6, 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.