pycom10g22810

receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
Physical Location & Seq
Reverse (-)
25117475 .. 25121071
3597 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 396 bp
ATGGCAAGATTTCTCATCATGCTCACGTTGATCCTTTGCTTCTCCTCATCATCAACAGTCAAAATTGAAGCACAGTCTCAATCTGATCCTAAAGAAGTGGAAACACTAAAGGAAATAGCTAAACAAATTGGGAAAAAAGACTGGAACTTCAGCATAGACCCATGCATCAATGACACAAATTGGGCTACACCAAAATCTGCTGACTTGCCTCGCTACAACAACACTGTCATCTGCAACTGCTCCACGCCTGATGGTTTTTGCCATGTTGTCAGCATGTATGCTAACTTTTTTCTTTTGAACAGAAGCCATAGTGCTAATTCATTGAAAAAAATATTACAACATAATTACAAGGGTGCCATAACCAGGTATAACTTTATCAATTACCCAAATCTTTAA

Protein Analysis

132

Amino Acids

14.91

Weight (kDa)

8.84

Isoelectric Point (pI)

33.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 353
AclWI GGATC 2 cut(s) 25, 80
AcuI CTGAAG 1 cut(s) 133
AfiI CCNNNNNNNGG 1 cut(s) 363
AgsI TTSAA 3 cut(s) 68, 298, 325
AjnI CCWGG 1 cut(s) 362
AluBI AGCT 1 cut(s) 119
AluI AGCT 1 cut(s) 119
Alw26I GTCTC 1 cut(s) 81
AlwI GGATC 2 cut(s) 25, 80
BanI GGYRCC 1 cut(s) 353
BccI CCATC 1 cut(s) 245
BciT130I CCWGG 1 cut(s) 364
BcoDI GTCTC 1 cut(s) 81
Bme1390I CCNGG 1 cut(s) 364
BmiI GGNNCC 1 cut(s) 355
BmrFI CCNGG 1 cut(s) 364
BmsI GCATC 1 cut(s) 174
Bsc4I CCNNNNNNNGG 1 cut(s) 363
Bse1I ACTGG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 364
BseLI CCNNNNNNNGG 1 cut(s) 363
BseNI ACTGG 1 cut(s) 146
BseRI GAGGAG 1 cut(s) 34
BshNI GGYRCC 1 cut(s) 353
BslI CCNNNNNNNGG 1 cut(s) 363
BsmAI GTCTC 1 cut(s) 81
Bsp143I GATC 2 cut(s) 30, 85
BspLI GGNNCC 1 cut(s) 355
BspPI GGATC 2 cut(s) 25, 80
BspT107I GGYRCC 1 cut(s) 353
BsrI ACTGG 1 cut(s) 146
BssMI GATC 2 cut(s) 30, 85
Bst2UI CCWGG 1 cut(s) 364
Bst4CI ACNGT 3 cut(s) 58, 75, 226
BstKTI GATC 2 cut(s) 33, 88
BstMAI GTCTC 1 cut(s) 81
BstMBI GATC 2 cut(s) 30, 85
BstNI CCWGG 1 cut(s) 364
BstNSI RCATGY 1 cut(s) 277
BstSCI CCNGG 1 cut(s) 362
BtsIMutI CAGTG 1 cut(s) 222
CsiI ACCWGGT 1 cut(s) 362
CviAII CATG 4 cut(s) 19, 162, 263, 274
CviJI RGCY 3 cut(s) 119, 185, 306
CviKI_1 RGCY 3 cut(s) 119, 185, 306
DpnI GATC 2 cut(s) 32, 87
DpnII GATC 2 cut(s) 30, 85
Eco57I CTGAAG 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 362
EcoT22I ATGCAT 1 cut(s) 167
FaeI CATG 4 cut(s) 22, 165, 266, 277
FatI CATG 4 cut(s) 18, 161, 262, 273
Hin1II CATG 4 cut(s) 22, 165, 266, 277
Hpy188I TCNGA 1 cut(s) 85
HpyCH4III ACNGT 3 cut(s) 58, 75, 226
HpyCH4IV ACGT 1 cut(s) 26
HpyCH4V TGCA 2 cut(s) 165, 234
HpySE526I ACGT 1 cut(s) 26
Hsp92II CATG 4 cut(s) 22, 165, 266, 277
Kzo9I GATC 2 cut(s) 30, 85
LmnI GCTCC 1 cut(s) 245
LpnPI CCDG 4 cut(s) 127, 261, 349, 376
LweI GCATC 1 cut(s) 174
MabI ACCWGGT 1 cut(s) 362
MaeII ACGT 1 cut(s) 26
MalI GATC 2 cut(s) 32, 87
MboI GATC 2 cut(s) 30, 85
MluCI AATT 6 cut(s) 63, 126, 178, 316, 343, 379
MnlI CCTC 2 cut(s) 55, 219
Mph1103I ATGCAT 1 cut(s) 167
MseI TTAA 1 cut(s) 394
MspR9I CCNGG 1 cut(s) 364
MvaI CCWGG 1 cut(s) 364
NdeII GATC 2 cut(s) 30, 85
NlaIII CATG 4 cut(s) 22, 165, 266, 277
NlaIV GGNNCC 1 cut(s) 355
NsiI ATGCAT 1 cut(s) 167
NspI RCATGY 1 cut(s) 277
Psp6I CCWGG 1 cut(s) 362
PspGI CCWGG 1 cut(s) 362
PspN4I GGNNCC 1 cut(s) 355
SaqAI TTAA 1 cut(s) 394
Sau3AI GATC 2 cut(s) 30, 85
ScrFI CCNGG 1 cut(s) 364
SetI ASST 3 cut(s) 29, 121, 368
SexAI ACCWGGT 1 cut(s) 362
SfaNI GCATC 1 cut(s) 174
Sse9I AATT 6 cut(s) 63, 126, 178, 316, 343, 379
SspI AATATT 1 cut(s) 333
StyD4I CCNGG 1 cut(s) 362
TaaI ACNGT 3 cut(s) 58, 75, 226
TaiI ACGT 1 cut(s) 29
TasI AATT 6 cut(s) 63, 126, 178, 316, 343, 379
Tru1I TTAA 1 cut(s) 394
Tru9I TTAA 1 cut(s) 394
TscAI CASTG 1 cut(s) 229
TspDTI ATGAA 1 cut(s) 309
TspRI CASTG 1 cut(s) 229
XceI RCATGY 1 cut(s) 277
Zsp2I ATGCAT 1 cut(s) 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.