Rh5DG089600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
7950155 .. 7967498
17344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG089600.1

Sequence Viewer

Length: 315 bp
ATGAAGCATGACATCATTATTCTCATGATCTTGGTTCTCTGCTTGATCTGCATAACATCACTCGAAGTTGAAGCAAAATGTTCGCCTCTTCCGCCTGCTGAAGGTAATAAAGAACTCAACTTTCTTCCACTTTGTCACTTCGATCACTTAGAGTTTCCTTTAATGAATGAAGTTGGTATTGGTAAAACTGAAAACCAATGCACTAAAGCTTTGCAAAATCCACTCAGACCCGGTAGCACTAGAACTCTAAGAGAAGCATCGCCACCTCAAAATGGAAAAGTGTGTGATCCAAACTTTCAACCGATTCCTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

104

Amino Acids

11.49

Weight (kDa)

5.85

Isoelectric Point (pI)

48.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AclWI GGATC 1 cut(s) 281
AcuI CTGAAG 1 cut(s) 120
AfiI CCNNNNNNNGG 3 cut(s) 101, 272, 308
AgsI TTSAA 2 cut(s) 71, 299
AjnI CCWGG 1 cut(s) 307
AjuI GAANNNNNNNTTGG 2 cut(s) 162, 194
AluBI AGCT 1 cut(s) 209
AluI AGCT 1 cut(s) 209
AlwI GGATC 1 cut(s) 281
AsuC2I CCSGG 1 cut(s) 231
BcgI CGANNNNNNTGC 2 cut(s) 63, 97
BciT130I CCWGG 1 cut(s) 309
BcnI CCSGG 1 cut(s) 231
BfaI CTAG 1 cut(s) 240
Bme1390I CCNGG 2 cut(s) 231, 309
BmrFI CCNGG 2 cut(s) 231, 309
BmsI GCATC 1 cut(s) 266
BpuMI CCSGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 3 cut(s) 101, 272, 308
BseBI CCWGG 1 cut(s) 309
BseLI CCNNNNNNNGG 3 cut(s) 101, 272, 308
BseMII CTCAG 1 cut(s) 238
BsiSI CCGG 1 cut(s) 231
BslI CCNNNNNNNGG 3 cut(s) 101, 272, 308
Bsp143I GATC 4 cut(s) 27, 45, 142, 286
BspACI CCGC 1 cut(s) 92
BspCNI CTCAG 1 cut(s) 237
BspHI TCATGA 1 cut(s) 24
BspPI GGATC 1 cut(s) 281
BssMI GATC 4 cut(s) 27, 45, 142, 286
Bst2UI CCWGG 1 cut(s) 309
Bst6I CTCTTC 1 cut(s) 93
BstC8I GCNNGC 1 cut(s) 96
BstDEI CTNAG 3 cut(s) 148, 224, 248
BstENI CCTNNNNNAGG 1 cut(s) 99
BstKTI GATC 4 cut(s) 30, 48, 145, 289
BstMBI GATC 4 cut(s) 27, 45, 142, 286
BstMWI GCNNNNNNNGC 2 cut(s) 48, 91
BstNI CCWGG 1 cut(s) 309
BstSCI CCNGG 2 cut(s) 229, 307
BtgZI GCGATG 1 cut(s) 243
Cac8I GCNNGC 1 cut(s) 96
CciI TCATGA 1 cut(s) 24
CviAII CATG 2 cut(s) 8, 25
CviJI RGCY 1 cut(s) 209
CviKI_1 RGCY 1 cut(s) 209
DdeI CTNAG 3 cut(s) 148, 224, 248
DpnI GATC 4 cut(s) 29, 47, 144, 288
DpnII GATC 4 cut(s) 27, 45, 142, 286
Eam1104I CTCTTC 1 cut(s) 93
EarI CTCTTC 1 cut(s) 93
EciI GGCGGA 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 120
EcoNI CCTNNNNNAGG 1 cut(s) 99
EcoRII CCWGG 1 cut(s) 307
FaeI CATG 2 cut(s) 11, 28
FaiI YATR 3 cut(s) 9, 26, 53
FatI CATG 2 cut(s) 7, 24
FspBI CTAG 1 cut(s) 240
HapII CCGG 1 cut(s) 231
Hin1II CATG 2 cut(s) 11, 28
HindIII AAGCTT 1 cut(s) 207
HinfI GANTC 1 cut(s) 304
HpaII CCGG 1 cut(s) 231
Hpy188I TCNGA 1 cut(s) 227
Hpy188III TCNNGA 1 cut(s) 25
HpyAV CCTTC 1 cut(s) 95
HpyCH4V TGCA 3 cut(s) 51, 201, 214
HpyF10VI GCNNNNNNNGC 2 cut(s) 48, 91
HpyF3I CTNAG 3 cut(s) 148, 224, 248
Hsp92II CATG 2 cut(s) 11, 28
Kzo9I GATC 4 cut(s) 27, 45, 142, 286
LpnPI CCDG 3 cut(s) 108, 244, 294
LweI GCATC 1 cut(s) 266
MaeI CTAG 1 cut(s) 240
MaeIII GTNAC 1 cut(s) 134
MalI GATC 4 cut(s) 29, 47, 144, 288
MboI GATC 4 cut(s) 27, 45, 142, 286
MboII GAAGA 2 cut(s) 80, 116
MnlI CCTC 2 cut(s) 96, 276
MseI TTAA 1 cut(s) 161
MspI CCGG 1 cut(s) 231
MspR9I CCNGG 2 cut(s) 231, 309
MvaI CCWGG 1 cut(s) 309
MwoI GCNNNNNNNGC 2 cut(s) 48, 91
NciI CCSGG 1 cut(s) 231
NdeII GATC 4 cut(s) 27, 45, 142, 286
NlaIII CATG 2 cut(s) 11, 28
NmuCI GTSAC 1 cut(s) 134
PagI TCATGA 1 cut(s) 24
PfeI GAWTC 1 cut(s) 304
Psp6I CCWGG 1 cut(s) 307
PspGI CCWGG 1 cut(s) 307
SaqAI TTAA 1 cut(s) 161
Sau3AI GATC 4 cut(s) 27, 45, 142, 286
ScrFI CCNGG 2 cut(s) 231, 309
SetI ASST 3 cut(s) 106, 211, 268
SfaNI GCATC 1 cut(s) 266
SgeI CNNG 9 cut(s) 20, 37, 43, 55, 74, 107, 242, 243, 252
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 240
StyD4I CCNGG 2 cut(s) 229, 307
TaqI TCGA 2 cut(s) 63, 141
TfiI GAWTC 1 cut(s) 304
Tru1I TTAA 1 cut(s) 161
Tru9I TTAA 1 cut(s) 161
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
TspDTI ATGAA 3 cut(s) 17, 179, 183
XagI CCTNNNNNAGG 1 cut(s) 99
XspI CTAG 1 cut(s) 240
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.