RchiOBHm_Chr4g0403421

antiporter activity

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
22638506 .. 22638826
321 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGGGCATTCCTACTTCAATATTATTAGCTTTTGTATTTCACATTGGAGGAAAGGGTCTTTGGATGGGAATCATCGTTGCACTGTTTGTGCAAGCACTATTTCTGGGAATCATAATCTTATTCACAGATTGGGAGAAAGAAGTAAACTGCTTCTTCAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

53

Amino Acids

5.92

Weight (kDa)

5.43

Isoelectric Point (pI)

25.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0000521)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g09990 FvH4_4g09990 FvH4_4g09990 FvH4_4g09990 FvH4_7g32860 FvH4_7g32860 FvH4_7g32860 FvH4_7g32860
malus_domestica MD11G1148000.v1.1 MD13G1266200.v1.1 MD14G1231800.v1.1
prunus_persica Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1
pyrus_communis pycom13g23330
rosa_chinensis RchiOBHm_Chr4g0403401 RchiOBHm_Chr4g0403411 RchiOBHm_Chr4g0403421 RchiOBHm_Chr4g0403461 RchiOBHm_Chr4g0403631 RchiOBHm_Chr7g0223601 RchiOBHm_Chr7g0238161
rosa_laevigata RLG00000000937 RLG00000001957 RLG00000008965 RLG00000008975 RLG00000008976 RLG00000008978
rosa_multiflora Rmu_co8335743.1_g000001 Rmu_sc0005734.1_g000001 Rmu_sc0007727.1_g000011 Rmu_sc0011775.1_g000002 Rmu_sc0011775.1_g000005 Rmu_sc0028062.1_g000002
rosa_roxburghii Rroxscaffold_3G00223300 Rroxscaffold_5G00348050 Rroxscaffold_5G00348060 Rroxscaffold_5G00348120 Rroxscaffold_5G00348240
rosa_rugosa Rorug04G0042300 Rorug04G0042400 Rorug04G0042500 Rorug04G0042600.1 Rorug04G0042700 Rorug04G0042800 Rorug04G0042900 Rorug04G0043000 Rorug04G0043100 Rorug04G0043200 Rorug04G0043300 Rorug04G0043400 Rorug04G0044700 Rorug07G0310600 Rorug07G0310700 Rorug07G0310700
rosa_samantha Rh4AG118700 Rh4AG118800 Rh4AG118900 Rh4AG119000 Rh4BG111600 Rh4BG111800 Rh4BG111900 Rh4BG112900 Rh4CG126600 Rh4CG126900 Rh4CG127800 Rh4DG111300 Rh4DG111400 Rh4DG111500 Rh7AG466500 Rh7BG352200 Rh7BG436900 Rh7CG484200 Rh7DG452600
rosa_wichuraiana Rw4G009630 Rw4G009640 Rw4G009650 Rw4G009710 Rw7G038620

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 139
AgsI TTSAA 1 cut(s) 18
AjuI GAANNNNNNNTTGG 2 cut(s) 43, 75
AluBI AGCT 1 cut(s) 29
AluI AGCT 1 cut(s) 29
BccI CCATC 1 cut(s) 58
BsaBI GATNNNNATC 1 cut(s) 68
Bse8I GATNNNNATC 1 cut(s) 68
BseGI GGATG 1 cut(s) 69
BseJI GATNNNNATC 1 cut(s) 68
BsmI GAATGC 1 cut(s) 6
Bst4CI ACNGT 1 cut(s) 84
BstC8I GCNNGC 1 cut(s) 93
BstF5I GGATG 1 cut(s) 69
BtsCI GGATG 1 cut(s) 69
BtsIMutI CAGTG 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 93
CviJI RGCY 1 cut(s) 29
CviKI_1 RGCY 1 cut(s) 29
Eco57I CTGAAG 1 cut(s) 139
FaiI YATR 1 cut(s) 113
FokI GGATG 1 cut(s) 76
HinfI GANTC 2 cut(s) 69, 108
Hpy166II GTNNAC 1 cut(s) 145
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 80, 91
LpnPI CCDG 1 cut(s) 89
MboII GAAGA 1 cut(s) 145
MnlI CCTC 1 cut(s) 41
Mva1269I GAATGC 1 cut(s) 6
PctI GAATGC 1 cut(s) 6
PfeI GAWTC 2 cut(s) 69, 108
SetI ASST 1 cut(s) 31
SgeI CNNG 2 cut(s) 104, 116
SspI AATATT 1 cut(s) 21
TaaI ACNGT 1 cut(s) 84
TfiI GAWTC 2 cut(s) 69, 108
TscAI CASTG 1 cut(s) 87
TspRI CASTG 1 cut(s) 87
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.