Rmu_sc0011775.1_g000002

Belongs to the multi antimicrobial extrusion (MATE) (TC 2.A.66.1) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011775.1
OG0000521
Physical Location & Seq
Forward (+)
2193 .. 3199
1007 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011775.1_g000002.1.cds

Sequence Viewer

Length: 438 bp
atggctgacaaagaacaatatgcaaatctcgaatcacccctgataccggtggtactggcccaagaacatgcattacgctcaaccaaggggcagcttacgaaagacgaatttctaaggaaactgaagaagcagctattgctggtagggccgctagtatcatcaaatttcttgctatatgatatgcaggctatttcagtaatgtatgttggtcatcttggggaactatcacttgcaggtgcttctacggcaacttcttttgcatcagtcactgaaattggggatcggggaaattgggaattggggattggggaaattggaaagaaattggggatcggggtgcagaagaagaactggagagtggagagtagagaagagagcttagaacagacattagtgaattggggatcgactgatcgaggtcttcgtttagaggcttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
MatE

Protein Analysis

145

Amino Acids

15.99

Weight (kDa)

6.14

Isoelectric Point (pI)

28.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000521)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g09990 FvH4_4g09990 FvH4_4g09990 FvH4_4g09990 FvH4_7g32860 FvH4_7g32860 FvH4_7g32860 FvH4_7g32860
malus_domestica MD11G1148000.v1.1 MD13G1266200.v1.1 MD14G1231800.v1.1
prunus_persica Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090100_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1 Prupe.1G090300_v2.0.a1
pyrus_communis pycom13g23330
rosa_chinensis RchiOBHm_Chr4g0403401 RchiOBHm_Chr4g0403411 RchiOBHm_Chr4g0403421 RchiOBHm_Chr4g0403461 RchiOBHm_Chr4g0403631 RchiOBHm_Chr7g0223601 RchiOBHm_Chr7g0238161
rosa_laevigata RLG00000000937 RLG00000001957 RLG00000008965 RLG00000008975 RLG00000008976 RLG00000008978
rosa_multiflora Rmu_co8335743.1_g000001 Rmu_sc0005734.1_g000001 Rmu_sc0007727.1_g000011 Rmu_sc0011775.1_g000002 Rmu_sc0011775.1_g000005 Rmu_sc0028062.1_g000002
rosa_roxburghii Rroxscaffold_3G00223300 Rroxscaffold_5G00348050 Rroxscaffold_5G00348060 Rroxscaffold_5G00348120 Rroxscaffold_5G00348240
rosa_rugosa Rorug04G0042300 Rorug04G0042400 Rorug04G0042500 Rorug04G0042600.1 Rorug04G0042700 Rorug04G0042800 Rorug04G0042900 Rorug04G0043000 Rorug04G0043100 Rorug04G0043200 Rorug04G0043300 Rorug04G0043400 Rorug04G0044700 Rorug07G0310600 Rorug07G0310700 Rorug07G0310700
rosa_samantha Rh4AG118700 Rh4AG118800 Rh4AG118900 Rh4AG119000 Rh4BG111600 Rh4BG111800 Rh4BG111900 Rh4BG112900 Rh4CG126600 Rh4CG126900 Rh4CG127800 Rh4DG111300 Rh4DG111400 Rh4DG111500 Rh7AG466500 Rh7BG352200 Rh7BG436900 Rh7CG484200 Rh7DG452600
rosa_wichuraiana Rw4G009630 Rw4G009640 Rw4G009650 Rw4G009710 Rw7G038620

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 224
Acc36I ACCTGC 1 cut(s) 224
AciI CCGC 1 cut(s) 149
AclWI GGATC 3 cut(s) 288, 338, 412
AcsI RAATTY 2 cut(s) 107, 163
AcuI CTGAAG 1 cut(s) 143
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 46
AgeI ACCGGT 1 cut(s) 46
AjuI GAANNNNNNNTTGG 2 cut(s) 288, 320
AluBI AGCT 3 cut(s) 94, 133, 378
AluI AGCT 3 cut(s) 94, 133, 378
AlwI GGATC 3 cut(s) 288, 338, 412
AlwNI CAGNNNCTG 1 cut(s) 269
AoxI GGCC 2 cut(s) 57, 146
ApeKI GCWGC 2 cut(s) 91, 130
ApoI RAATTY 2 cut(s) 107, 163
AsiGI ACCGGT 1 cut(s) 46
AspS9I GGNCC 2 cut(s) 58, 146
AsuHPI GGTGA 1 cut(s) 27
BbsI GAAGAC 1 cut(s) 413
BbvI GCAGC 2 cut(s) 103, 142
BceAI ACGGC 1 cut(s) 261
BfaI CTAG 1 cut(s) 152
BfuAI ACCTGC 1 cut(s) 224
BisI GCNGC 3 cut(s) 92, 131, 149
BlsI GCNGC 3 cut(s) 93, 132, 150
BmgT120I GGNCC 2 cut(s) 58, 146
BmsI GCATC 1 cut(s) 269
BpiI GAAGAC 1 cut(s) 413
BpmI CTGGAG 1 cut(s) 373
BsaJI CCNNGG 1 cut(s) 84
BsaWI WCCGGW 1 cut(s) 46
Bsc4I CCNNNNNNNGG 1 cut(s) 46
Bse118I RCCGGY 1 cut(s) 46
Bse1I ACTGG 2 cut(s) 60, 356
BseDI CCNNGG 1 cut(s) 84
BseLI CCNNNNNNNGG 1 cut(s) 46
BseNI ACTGG 2 cut(s) 60, 356
BseXI GCAGC 2 cut(s) 103, 142
BsgI GTGCAG 1 cut(s) 359
BshFI GGCC 2 cut(s) 59, 148
BshTI ACCGGT 1 cut(s) 46
BsiSI CCGG 1 cut(s) 47
BslI CCNNNNNNNGG 1 cut(s) 46
BsnI GGCC 2 cut(s) 59, 148
Bsp143I GATC 4 cut(s) 280, 330, 404, 412
BspACI CCGC 1 cut(s) 149
BspANI GGCC 2 cut(s) 59, 148
BspMI ACCTGC 1 cut(s) 224
BspPI GGATC 3 cut(s) 288, 338, 412
BsrFI RCCGGY 1 cut(s) 46
BsrI ACTGG 2 cut(s) 60, 356
BssAI RCCGGY 1 cut(s) 46
BssECI CCNNGG 1 cut(s) 84
BssMI GATC 4 cut(s) 280, 330, 404, 412
BssT1I CCWWGG 1 cut(s) 84
Bst6I CTCTTC 1 cut(s) 366
BstAPI GCANNNNNTGC 1 cut(s) 136
BstC8I GCNNGC 1 cut(s) 186
BstDEI CTNAG 3 cut(s) 113, 379, 435
BstKTI GATC 4 cut(s) 283, 333, 407, 415
BstMBI GATC 4 cut(s) 280, 330, 404, 412
BstMWI GCNNNNNNNGC 3 cut(s) 136, 145, 245
BstNSI RCATGY 1 cut(s) 71
BstV1I GCAGC 2 cut(s) 103, 142
BstV2I GAAGAC 1 cut(s) 413
BsuRI GGCC 2 cut(s) 59, 148
BtsIMutI CAGTG 1 cut(s) 267
BveI ACCTGC 1 cut(s) 224
Cac8I GCNNGC 1 cut(s) 186
CaiI CAGNNNCTG 1 cut(s) 269
Cfr10I RCCGGY 1 cut(s) 46
Cfr13I GGNCC 2 cut(s) 58, 146
Csp6I GTAC 1 cut(s) 53
CspAI ACCGGT 1 cut(s) 46
CviAII CATG 1 cut(s) 68
CviJI RGCY 8 cut(s) 5, 59, 94, 133, 148, 188, 378, 434
CviKI_1 RGCY 8 cut(s) 5, 59, 94, 133, 148, 188, 378, 434
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 3 cut(s) 113, 379, 435
DpnI GATC 4 cut(s) 282, 332, 406, 414
DpnII GATC 4 cut(s) 280, 330, 404, 412
Eam1104I CTCTTC 1 cut(s) 366
EarI CTCTTC 1 cut(s) 366
Eco130I CCWWGG 1 cut(s) 84
Eco57I CTGAAG 1 cut(s) 143
EcoT14I CCWWGG 1 cut(s) 84
EcoT22I ATGCAT 1 cut(s) 73
ErhI CCWWGG 1 cut(s) 84
FaeI CATG 1 cut(s) 71
FaiI YATR 6 cut(s) 21, 69, 175, 177, 182, 204
FatI CATG 1 cut(s) 67
Fnu4HI GCNGC 3 cut(s) 92, 131, 149
Fsp4HI GCNGC 3 cut(s) 92, 131, 149
FspBI CTAG 1 cut(s) 152
GluI GCNGC 3 cut(s) 92, 131, 149
GsuI CTGGAG 1 cut(s) 373
HaeIII GGCC 2 cut(s) 59, 148
HapII CCGG 1 cut(s) 47
Hin1II CATG 1 cut(s) 71
HinfI GANTC 1 cut(s) 32
HpaII CCGG 1 cut(s) 47
HphI GGTGA 1 cut(s) 27
Hpy188III TCNNGA 1 cut(s) 29
HpyCH4V TGCA 6 cut(s) 23, 71, 184, 233, 260, 340
HpyF10VI GCNNNNNNNGC 3 cut(s) 136, 145, 245
HpyF3I CTNAG 3 cut(s) 113, 379, 435
Hsp92II CATG 1 cut(s) 71
Kzo9I GATC 4 cut(s) 280, 330, 404, 412
LpnPI CCDG 7 cut(s) 41, 53, 60, 125, 170, 219, 337
Lsp1109I GCAGC 2 cut(s) 103, 142
LweI GCATC 1 cut(s) 269
MaeI CTAG 1 cut(s) 152
MaeIII GTNAC 1 cut(s) 265
MalI GATC 4 cut(s) 282, 332, 406, 414
MboI GATC 4 cut(s) 280, 330, 404, 412
MboII GAAGA 5 cut(s) 136, 355, 358, 383, 413
MluCI AATT 8 cut(s) 107, 163, 273, 289, 296, 312, 323, 397
MnlI CCTC 2 cut(s) 410, 424
Mph1103I ATGCAT 1 cut(s) 73
MspI CCGG 1 cut(s) 47
MwoI GCNNNNNNNGC 3 cut(s) 136, 145, 245
NdeII GATC 4 cut(s) 280, 330, 404, 412
NlaIII CATG 1 cut(s) 71
NmuCI GTSAC 1 cut(s) 265
NsiI ATGCAT 1 cut(s) 73
NspI RCATGY 1 cut(s) 71
PaqCI CACCTGC 1 cut(s) 224
PcsI WCGNNNNNNNCGW 1 cut(s) 421
PfeI GAWTC 1 cut(s) 32
PinAI ACCGGT 1 cut(s) 46
PkrI GCNGC 3 cut(s) 93, 132, 150
PspPI GGNCC 2 cut(s) 58, 146
PsrI GAACNNNNNNTAC 2 cut(s) 57, 89
PstNI CAGNNNCTG 1 cut(s) 269
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
SatI GCNGC 3 cut(s) 92, 131, 149
Sau3AI GATC 4 cut(s) 280, 330, 404, 412
Sau96I GGNCC 2 cut(s) 58, 146
SetI ASST 5 cut(s) 96, 135, 238, 380, 421
SfaNI GCATC 1 cut(s) 269
Sse9I AATT 8 cut(s) 107, 163, 273, 289, 296, 312, 323, 397
SsiI CCGC 1 cut(s) 149
SspMI CTAG 1 cut(s) 152
StyI CCWWGG 1 cut(s) 84
TaqI TCGA 3 cut(s) 30, 407, 415
TasI AATT 8 cut(s) 107, 163, 273, 289, 296, 312, 323, 397
TauI GCSGC 1 cut(s) 151
TfiI GAWTC 1 cut(s) 32
TscAI CASTG 1 cut(s) 274
TseFI GTSAC 1 cut(s) 265
TseI GCWGC 2 cut(s) 91, 130
Tsp45I GTSAC 1 cut(s) 265
TspRI CASTG 1 cut(s) 274
XapI RAATTY 2 cut(s) 107, 163
XceI RCATGY 1 cut(s) 71
XspI CTAG 1 cut(s) 152
Zsp2I ATGCAT 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.