RchiOBHm_Chr2g0122101

septum site-determining protein minD homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
34959003 .. 34959207
205 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGCCACTCCTTTCTTTGTTCTCTTTCCTCTCTCTCAACAACCGCGTCACCGACGTCGGTCTTTGGAATCTCTACCTCCTCATCAGTCTCGAGAACCGCGTCAAATATACCGTCGTCGAGGTCCTCAATGATGACTAG

Protein Analysis

45

Amino Acids

5.23

Weight (kDa)

4.58

Isoelectric Point (pI)

21.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 57
AccII CGCG 2 cut(s) 45, 99
AciI CCGC 2 cut(s) 43, 97
AcyI GRCGYC 1 cut(s) 54
Alw26I GTCTC 1 cut(s) 92
Ama87I CYCGRG 1 cut(s) 89
ArsI GACNNNNNNTTYG 2 cut(s) 96, 128
AspS9I GGNCC 1 cut(s) 121
AsuHPI GGTGA 1 cut(s) 40
AvaI CYCGRG 1 cut(s) 89
AvaII GGWCC 1 cut(s) 121
BcoDI GTCTC 1 cut(s) 92
BfaI CTAG 1 cut(s) 136
Bme18I GGWCC 1 cut(s) 121
BmeT110I CYCGRG 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 121
BoxI GACNNNNGTC 1 cut(s) 57
BsaHI GRCGYC 1 cut(s) 54
BseRI GAGGAG 1 cut(s) 68
Bsh1236I CGCG 2 cut(s) 45, 99
BsiHKCI CYCGRG 1 cut(s) 89
BsmAI GTCTC 1 cut(s) 92
BsoBI CYCGRG 1 cut(s) 89
BspACI CCGC 2 cut(s) 43, 97
BspFNI CGCG 2 cut(s) 45, 99
BssNI GRCGYC 1 cut(s) 54
Bst4CI ACNGT 1 cut(s) 112
BstACI GRCGYC 1 cut(s) 54
BstFNI CGCG 2 cut(s) 45, 99
BstMAI GTCTC 1 cut(s) 92
BstPAI GACNNNNGTC 1 cut(s) 57
BstUI CGCG 2 cut(s) 45, 99
Cfr13I GGNCC 1 cut(s) 121
CseI GACGC 2 cut(s) 34, 88
Eco47I GGWCC 1 cut(s) 121
Eco88I CYCGRG 1 cut(s) 89
EcoO109I RGGNCCY 1 cut(s) 121
FaiI YATR 1 cut(s) 108
FspBI CTAG 1 cut(s) 136
HgaI GACGC 2 cut(s) 34, 88
Hin1I GRCGYC 1 cut(s) 54
HinfI GANTC 1 cut(s) 67
HphI GGTGA 1 cut(s) 40
Hpy188III TCNNGA 2 cut(s) 89, 91
Hpy99I CGWCG 4 cut(s) 56, 59, 116, 119
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 54
HpySE526I ACGT 1 cut(s) 54
Hsp92I GRCGYC 1 cut(s) 54
MaeI CTAG 1 cut(s) 136
MaeII ACGT 1 cut(s) 54
MaeIII GTNAC 1 cut(s) 46
MnlI CCTC 5 cut(s) 38, 86, 89, 112, 134
MvnI CGCG 2 cut(s) 45, 99
NmuCI GTSAC 1 cut(s) 46
PaeR7I CTCGAG 1 cut(s) 89
PcsI WCGNNNNNNNCGW 1 cut(s) 96
PfeI GAWTC 1 cut(s) 67
PpuMI RGGWCCY 1 cut(s) 121
PshAI GACNNNNGTC 1 cut(s) 57
Psp5II RGGWCCY 1 cut(s) 121
PspPI GGNCC 1 cut(s) 121
PspPPI RGGWCCY 1 cut(s) 121
Sau96I GGNCC 1 cut(s) 121
SetI ASST 3 cut(s) 57, 78, 123
Sfr274I CTCGAG 1 cut(s) 89
SgeI CNNG 5 cut(s) 56, 101, 103, 110, 130
SinI GGWCC 1 cut(s) 121
SlaI CTCGAG 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
SsiI CCGC 2 cut(s) 43, 97
SspMI CTAG 1 cut(s) 136
TaaI ACNGT 1 cut(s) 112
TaiI ACGT 1 cut(s) 57
TaqI TCGA 2 cut(s) 90, 117
TaqII GACCGA 1 cut(s) 47
TfiI GAWTC 1 cut(s) 67
TseFI GTSAC 1 cut(s) 46
Tsp45I GTSAC 1 cut(s) 46
VpaK11BI GGWCC 1 cut(s) 121
XhoI CTCGAG 1 cut(s) 89
XspI CTAG 1 cut(s) 136
ZraI GACGTC 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.