Rh5DG526800

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
OG0001139
Physical Location & Seq
Forward (+)
81436344 .. 81436599
256 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG526800.1

Sequence Viewer

Length: 162 bp
ATGGCTCAATTGAAACTCATCACCGCTCTTTTTGTCTCCTGCGTTCTTCTACCTTTGACTCATGCCATTAGCTACTGCGCACTTAGGAATGGACTGGACAAAAAGGTGAAGTCAAGGAAGCAACTCAAGGAAAGGAAGAACAGAGCTAAGAAGATCCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.09

Weight (kDa)

10.83

Isoelectric Point (pI)

21.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 79
AccBSI CCGCTC 1 cut(s) 26
AciI CCGC 1 cut(s) 24
AclWI GGATC 1 cut(s) 148
AgsI TTSAA 1 cut(s) 13
AluBI AGCT 2 cut(s) 72, 146
AluI AGCT 2 cut(s) 72, 146
Alw26I GTCTC 1 cut(s) 40
AlwI GGATC 1 cut(s) 148
AspLEI GCGC 1 cut(s) 80
AsuHPI GGTGA 2 cut(s) 13, 118
BcoDI GTCTC 1 cut(s) 40
BpuEI CTTGAG 1 cut(s) 110
Bse1I ACTGG 1 cut(s) 99
BseNI ACTGG 1 cut(s) 99
BsmAI GTCTC 1 cut(s) 40
Bsp143I GATC 1 cut(s) 153
BspACI CCGC 1 cut(s) 24
BspPI GGATC 1 cut(s) 148
BsrBI CCGCTC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 99
BssMI GATC 1 cut(s) 153
BstDEI CTNAG 2 cut(s) 83, 147
BstHHI GCGC 1 cut(s) 80
BstKTI GATC 1 cut(s) 156
BstMAI GTCTC 1 cut(s) 40
BstMBI GATC 1 cut(s) 153
BstX2I RGATCY 1 cut(s) 153
BstYI RGATCY 1 cut(s) 153
CfoI GCGC 1 cut(s) 80
CviAII CATG 1 cut(s) 62
CviJI RGCY 3 cut(s) 5, 72, 146
CviKI_1 RGCY 3 cut(s) 5, 72, 146
DdeI CTNAG 2 cut(s) 83, 147
DpnI GATC 1 cut(s) 155
DpnII GATC 1 cut(s) 153
FaeI CATG 1 cut(s) 65
FaiI YATR 1 cut(s) 63
FatI CATG 1 cut(s) 61
FspI TGCGCA 1 cut(s) 79
GlaI GCGC 1 cut(s) 79
HhaI GCGC 1 cut(s) 80
Hin1II CATG 1 cut(s) 65
Hin6I GCGC 1 cut(s) 78
HinP1I GCGC 1 cut(s) 78
HinfI GANTC 1 cut(s) 58
HphI GGTGA 2 cut(s) 13, 118
HpyF3I CTNAG 2 cut(s) 83, 147
Hsp92II CATG 1 cut(s) 65
HspAI GCGC 1 cut(s) 78
Kzo9I GATC 1 cut(s) 153
LpnPI CCDG 2 cut(s) 52, 80
MalI GATC 1 cut(s) 155
MbiI CCGCTC 1 cut(s) 26
MboI GATC 1 cut(s) 153
MboII GAAGA 2 cut(s) 38, 148
MfeI CAATTG 1 cut(s) 8
MflI RGATCY 1 cut(s) 153
MluCI AATT 1 cut(s) 8
MlyI GAGTC 1 cut(s) 52
MunI CAATTG 1 cut(s) 8
NdeII GATC 1 cut(s) 153
NlaIII CATG 1 cut(s) 65
NsbI TGCGCA 1 cut(s) 79
PleI GAGTC 1 cut(s) 52
PpsI GAGTC 1 cut(s) 52
PsuI RGATCY 1 cut(s) 153
Sau3AI GATC 1 cut(s) 153
SchI GAGTC 1 cut(s) 52
SetI ASST 4 cut(s) 55, 74, 108, 148
SgeI CNNG 5 cut(s) 51, 74, 107, 126, 139
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 1 cut(s) 8
SsiI CCGC 1 cut(s) 24
TasI AATT 1 cut(s) 8
TspGWI ACGGA 1 cut(s) 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.