Rh4BG202200

amine oxidase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
Physical Location & Seq
Reverse (-)
34674179 .. 34674332
154 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG202200.1

Sequence Viewer

Length: 154 bp
ATGGGGCCACTGGAGGGGATATTTTTGGTTGTTGATCTTGATGAATTGAAGATAGTTGAATACTATGGTAGAGTTAGGGTTCCTGTGCCAATATGGGAGGGGACCGTGTACCGATTGTCGAAGCAAAAACCGCCATTCAGTCCCCCACTGCAAG

Protein Analysis

51

Amino Acids

5.87

Weight (kDa)

6.09

Isoelectric Point (pI)

35.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 131
AfaI GTAC 1 cut(s) 110
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 2 cut(s) 49, 59
AoxI GGCC 1 cut(s) 5
AspS9I GGNCC 2 cut(s) 5, 102
AvaII GGWCC 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 102
BmgT120I GGNCC 2 cut(s) 5, 102
BmiI GGNNCC 3 cut(s) 6, 81, 103
BpmI CTGGAG 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse1I ACTGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 14
BseNI ACTGG 1 cut(s) 15
BshFI GGCC 1 cut(s) 7
BslFI GGGAC 2 cut(s) 115, 126
BslI CCNNNNNNNGG 1 cut(s) 14
BsmFI GGGAC 2 cut(s) 115, 126
BsnI GGCC 1 cut(s) 7
Bsp143I GATC 1 cut(s) 34
BspACI CCGC 1 cut(s) 131
BspANI GGCC 1 cut(s) 7
BspLI GGNNCC 3 cut(s) 6, 81, 103
BsrI ACTGG 1 cut(s) 15
BssMI GATC 1 cut(s) 34
Bst4CI ACNGT 1 cut(s) 106
BstKTI GATC 1 cut(s) 37
BstMBI GATC 1 cut(s) 34
BstMWI GCNNNNNNNGC 1 cut(s) 130
BsuRI GGCC 1 cut(s) 7
BtsI GCAGTG 1 cut(s) 146
BtsIMutI CAGTG 2 cut(s) 8, 146
Cfr13I GGNCC 2 cut(s) 5, 102
Csp6I GTAC 1 cut(s) 109
CviJI RGCY 1 cut(s) 7
CviKI_1 RGCY 1 cut(s) 7
CviQI GTAC 1 cut(s) 109
DpnI GATC 1 cut(s) 36
DpnII GATC 1 cut(s) 34
Eco47I GGWCC 1 cut(s) 102
FaiI YATR 2 cut(s) 66, 94
FaqI GGGAC 2 cut(s) 115, 126
GsuI CTGGAG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 7
Hpy166II GTNNAC 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 38
Hpy8I GTNNAC 1 cut(s) 109
HpyCH4III ACNGT 1 cut(s) 106
HpyCH4V TGCA 1 cut(s) 151
HpyF10VI GCNNNNNNNGC 1 cut(s) 130
Kzo9I GATC 1 cut(s) 34
LpnPI CCDG 1 cut(s) 96
MalI GATC 1 cut(s) 36
MboI GATC 1 cut(s) 34
MboII GAAGA 1 cut(s) 61
MluCI AATT 1 cut(s) 44
MnlI CCTC 2 cut(s) 7, 91
MwoI GCNNNNNNNGC 1 cut(s) 130
NdeII GATC 1 cut(s) 34
NlaIV GGNNCC 3 cut(s) 6, 81, 103
PspN4I GGNNCC 3 cut(s) 6, 81, 103
PspPI GGNCC 2 cut(s) 5, 102
RsaI GTAC 1 cut(s) 110
RsaNI GTAC 1 cut(s) 109
Sau3AI GATC 1 cut(s) 34
Sau96I GGNCC 2 cut(s) 5, 102
SgeI CNNG 4 cut(s) 23, 50, 95, 118
SinI GGWCC 1 cut(s) 102
Sse9I AATT 1 cut(s) 44
SsiI CCGC 1 cut(s) 131
TaaI ACNGT 1 cut(s) 106
TaqI TCGA 1 cut(s) 119
TasI AATT 1 cut(s) 44
TscAI CASTG 2 cut(s) 15, 153
TspDTI ATGAA 1 cut(s) 57
TspRI CASTG 2 cut(s) 15, 153
VpaK11BI GGWCC 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.