RchiOBHm_Chr2g0151271

Belongs to the glyceraldehyde-3-phosphate dehydrogenase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
68911376 .. 68914941
3566 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGGTGAAGCTTATTCTTATTAGAAGGACAGGAGACATATTGCTATGGTCGAGCATTTTCAATGCCAAGGCTGGAATTGCTTTGAATGACAACTTTGTGAAGCTTGTCTCTTGGTATGATAACAAATGGCCTTGTAGTGAATATCTACCTATGCTGATATTCTATTTTTGGAATTCATAA

Protein Analysis

59

Amino Acids

7.02

Weight (kDa)

8.93

Isoelectric Point (pI)

43.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 172
AgsI TTSAA 2 cut(s) 61, 85
AluBI AGCT 2 cut(s) 10, 103
AluI AGCT 2 cut(s) 10, 103
Alw26I GTCTC 2 cut(s) 27, 112
AoxI GGCC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 172
AsuHPI GGTGA 1 cut(s) 16
BcoDI GTCTC 2 cut(s) 27, 112
BsaJI CCNNGG 1 cut(s) 66
BseDI CCNNGG 1 cut(s) 66
BshFI GGCC 1 cut(s) 130
BsmAI GTCTC 2 cut(s) 27, 112
BsnI GGCC 1 cut(s) 130
BspANI GGCC 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 66
BssT1I CCWWGG 1 cut(s) 66
BstMAI GTCTC 2 cut(s) 27, 112
BstMWI GCNNNNNNNGC 1 cut(s) 77
BsuRI GGCC 1 cut(s) 130
CviJI RGCY 4 cut(s) 10, 71, 103, 130
CviKI_1 RGCY 4 cut(s) 10, 71, 103, 130
Eco130I CCWWGG 1 cut(s) 66
EcoRI GAATTC 1 cut(s) 172
EcoT14I CCWWGG 1 cut(s) 66
ErhI CCWWGG 1 cut(s) 66
FaiI YATR 5 cut(s) 38, 46, 117, 152, 178
HaeIII GGCC 1 cut(s) 130
HindIII AAGCTT 2 cut(s) 8, 101
HphI GGTGA 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 18
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
LpnPI CCDG 2 cut(s) 15, 57
MluCI AATT 2 cut(s) 75, 172
MwoI GCNNNNNNNGC 1 cut(s) 77
SetI ASST 3 cut(s) 12, 105, 151
SgeI CNNG 7 cut(s) 42, 63, 79, 84, 116, 123, 144
Sse9I AATT 2 cut(s) 75, 172
StyI CCWWGG 1 cut(s) 66
TaqI TCGA 1 cut(s) 50
TasI AATT 2 cut(s) 75, 172
TspDTI ATGAA 1 cut(s) 165
XapI RAATTY 1 cut(s) 172
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.