Rroxscaffold_5G00339850

Required for replication-independent chromatin assembly and for the periodic repression of histone gene transcription during the cell cycle

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
8242968 .. 8245512
2545 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00339850.1

Sequence Viewer

Length: 261 bp
ATGATCAAAGTTATATCAGCAAAGCTATCAAGATCCGGATCTCCTCTTGTTGTCCTCGCTACTCGCCATGCCTTCCTTTTTGACATGGGACCGATGTGTTGGCTTAGGGTTGCAGATGACTTCTTTTCTGGGTTTTCTTGGTTGAGCATTTTCGATGCCAAGGCTGGAATTGCTTTGAATGACAACTTTGTGAAGCTTGTCTCTTGGTATGATAACAAATGGGCTTCGGTTTTAAGTATGGTGAATATGTATTATAAATGA

Protein Analysis

86

Amino Acids

9.79

Weight (kDa)

9.25

Isoelectric Point (pI)

33.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hira PF07569 3 - 44 3.2e-08 TUP1-like enhancer of split
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 255
AccIII TCCGGA 1 cut(s) 35
AclWI GGATC 2 cut(s) 27, 46
AgsI TTSAA 1 cut(s) 178
AluBI AGCT 2 cut(s) 25, 196
AluI AGCT 2 cut(s) 25, 196
Alw26I GTCTC 1 cut(s) 205
AlwI GGATC 2 cut(s) 27, 46
Aor13HI TCCGGA 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 253
AvaII GGWCC 1 cut(s) 89
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 205
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmiI GGNNCC 1 cut(s) 90
BmsI GCATC 1 cut(s) 145
Bpu10I CCTNAGC 1 cut(s) 104
BsaBI GATNNNNATC 1 cut(s) 37
BsaJI CCNNGG 1 cut(s) 159
BsaWI WCCGGW 1 cut(s) 35
Bse8I GATNNNNATC 1 cut(s) 37
BseAI TCCGGA 1 cut(s) 35
BseDI CCNNGG 1 cut(s) 159
BseJI GATNNNNATC 1 cut(s) 37
BseRI GAGGAG 1 cut(s) 33
BsiSI CCGG 1 cut(s) 36
BslFI GGGAC 1 cut(s) 102
BsmAI GTCTC 1 cut(s) 205
BsmFI GGGAC 1 cut(s) 102
Bsp13I TCCGGA 1 cut(s) 35
Bsp143I GATC 3 cut(s) 3, 32, 38
BspEI TCCGGA 1 cut(s) 35
BspLI GGNNCC 1 cut(s) 90
BspPI GGATC 2 cut(s) 27, 46
BssECI CCNNGG 1 cut(s) 159
BssMI GATC 3 cut(s) 3, 32, 38
BssT1I CCWWGG 1 cut(s) 159
BstDEI CTNAG 1 cut(s) 104
BstKTI GATC 3 cut(s) 6, 35, 41
BstMAI GTCTC 1 cut(s) 205
BstMBI GATC 3 cut(s) 3, 32, 38
BstMWI GCNNNNNNNGC 1 cut(s) 170
BstX2I RGATCY 2 cut(s) 32, 38
BstYI RGATCY 2 cut(s) 32, 38
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 2 cut(s) 68, 85
CviJI RGCY 5 cut(s) 25, 103, 164, 196, 224
CviKI_1 RGCY 5 cut(s) 25, 103, 164, 196, 224
DdeI CTNAG 1 cut(s) 104
DpnI GATC 3 cut(s) 5, 34, 40
DpnII GATC 3 cut(s) 3, 32, 38
Eco130I CCWWGG 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 159
ErhI CCWWGG 1 cut(s) 159
FaeI CATG 2 cut(s) 71, 88
FaiI YATR 7 cut(s) 14, 69, 86, 210, 239, 248, 255
FaqI GGGAC 1 cut(s) 102
FatI CATG 2 cut(s) 67, 84
FbaI TGATCA 1 cut(s) 3
HapII CCGG 1 cut(s) 36
Hin1II CATG 2 cut(s) 71, 88
HindIII AAGCTT 1 cut(s) 194
HpaII CCGG 1 cut(s) 36
HphI GGTGA 1 cut(s) 253
Hpy188III TCNNGA 2 cut(s) 30, 36
HpyAV CCTTC 1 cut(s) 82
HpyCH4V TGCA 1 cut(s) 113
HpyF10VI GCNNNNNNNGC 1 cut(s) 170
HpyF3I CTNAG 1 cut(s) 104
Hsp92II CATG 2 cut(s) 71, 88
Kpn2I TCCGGA 1 cut(s) 35
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 3 cut(s) 3, 32, 38
LpnPI CCDG 3 cut(s) 49, 114, 150
LweI GCATC 1 cut(s) 145
MalI GATC 3 cut(s) 5, 34, 40
MboI GATC 3 cut(s) 3, 32, 38
MflI RGATCY 2 cut(s) 32, 38
MluCI AATT 1 cut(s) 168
MnlI CCTC 2 cut(s) 54, 65
MroI TCCGGA 1 cut(s) 35
MseI TTAA 1 cut(s) 233
MspI CCGG 1 cut(s) 36
MwoI GCNNNNNNNGC 1 cut(s) 170
NdeII GATC 3 cut(s) 3, 32, 38
NlaIII CATG 2 cut(s) 71, 88
NlaIV GGNNCC 1 cut(s) 90
PsiI TTATAA 1 cut(s) 255
PspN4I GGNNCC 1 cut(s) 90
PspPI GGNCC 1 cut(s) 89
PsuI RGATCY 2 cut(s) 32, 38
SaqAI TTAA 1 cut(s) 233
Sau3AI GATC 3 cut(s) 3, 32, 38
Sau96I GGNCC 1 cut(s) 89
SetI ASST 2 cut(s) 27, 198
SfaNI GCATC 1 cut(s) 145
SinI GGWCC 1 cut(s) 89
Sse9I AATT 1 cut(s) 168
StyI CCWWGG 1 cut(s) 159
TaqI TCGA 1 cut(s) 153
TaqII GACCGA 1 cut(s) 106
TasI AATT 1 cut(s) 168
Tru1I TTAA 1 cut(s) 233
Tru9I TTAA 1 cut(s) 233
VpaK11BI GGWCC 1 cut(s) 89
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.